Allele-specific Silencing Therapy for DFNA9 Using Antisense Oligonucleotides
Abstract
The invention relates to the fields of medicine and immunology. In particular, it relates to novel antisense oligonucleotides that may be used in the treatment, prevention and/or delay of an COCH associated condition.
Claims (12)
1 . An antisense oligonucleotide moiety for the specific degradation of a mutated COCH transcript that binds to and/or is complementary to a polynucleotide part within the nucleotide sequence as set forward in SEQ ID NO: 1 or in SEQ ID NO: 2, wherein the polynucleotide e part has a nucleotide sequence selected from the group consisting of SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, and 26.
Show 11 dependent claims
2 . An antisense oligonucleotide for the degradation of a mutated COCH according to claim 1 , wherein the antisense oligonucleotide comprises an RNA residue, a DNA residue, and/or a nucleotide analogue or equivalent, preferably wherein the antisense oligonucleotide comprises both RNA and DNA residues.
3 . An antisense oligonucleotide for the degradation of a mutated COCH according to claim 1 , wherein the antisense nucleotide is a gapmer.
4 . An antisense oligonucleotide for the degradation of a mutated COCH according to claim 1 , wherein the antisense oligonucleotide has a length of from about 8 to about 40 nucleotides, preferably from about 10 to about 40 nucleotides, more preferably from about 14 to about 30 nucleotides, more preferably from about 16 to about 24 nucleotides, such as 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides.
5 . An antisense oligonucleotide for the degradation of a mutated COCH according to claim 1 , wherein said antisense oligonucleotide comprises or consists of an oligonucleotide with the sequence as set forward in SEQ ID NO: 2%-28, 29, 30, 31, 32, 33, 34, 35, 50, 53, 54, 55, 56 or 57.
6 . An antisense oligonucleotide for the degradation of a mutated COCH according claim 1 , comprising a 2′-O alkyl phosphorothioate modified nucleotide, such as a 2′-O-methyl modified ribose, a 2′-O-ethyl modified ribose, a 2′-O-propyl modified ribose, and/or substituted derivatives of these modifications such as halogenated derivatives.
7 . A pharmaceutical composition comprising an antisense oligonucleotide for the degradation of a mutated COCH according to- claim 1 and further comprising a pharmaceutically acceptable excipient.
8 . A pharmaceutical composition according to claim 7 , wherein the pharmaceutical composition is for administration into the cochlea.
9 . A method of treatment of a COCH related disease or condition requiring the degradation of mutated COCH (pre) mRNA in a subject in need thereof, comprising administration of an antisense oligonucleotide for the degradation of a mutated COCH as defined in claim 1 .
10 . The method according to claim 9 , wherein the COCH related disease or condition is a condition resulting in hearing impairment and/or vestibular dysfunction.
11 . The method according to claim 9 , wherein the COCH related disease or condition is a is a vestibulo-cochlear disorder.
12 . The method according to claim 9 , wherein the COCH related disease or condition is DFNA9.
Full Description
Show full text →
FIELD OF THE INVENTION
The invention relates to the fields of medicine and immunology. In particular, it relates to novel antisense oligonucleotides that may be used in the treatment, prevention and/or delay of conditions associated with genetic variants in COCH.
BACKGROUND OF THE INVENTION
DFNA9, caused by mutations in the COCH gene, is a relatively common form of dominantly inherited progressive hearing loss and vestibular dysfunction. It is characterized by late-onset hearing loss, leading to complete deafness by the age of 50-70 (Born et al., 2003; Robertson et al., 2006). With progression of the disease, speech perception and conversation become severely limited. DFNA9 patients furthermore suffer from balance problems, severely hampering their daily movements. Together, this negatively impacts the quality of life of patients and their friends and family members. The COCH gene is located on chromosome 14 (chr14:31,343,720-31,364,271 [GRCh37/hg19], NCBI reference sequence NG_008211.2), and encodes for cochlin, a protein that consists of 550 amino acids. Cochlin contains a signal peptide, an LCCL (Limulus factor C, Cochlin, and late gestation lung protein LgI1) domain, two short intervening domains, and two vWFA (von Willebrandfactor A) domains. Cochlin is expressed in the fibrocytes of the spiral ligament and spiral limbus, where it has been reported to assist in structural support, sound processing and maintenance of balance within the inner ear (Gallant et al., 2013). Proteolytic cleavage of cochlin, between the LCCL domain and the downstream vWFA domains, gives rise to a secreted 16-kDa LCCL domain-containing peptide that was shown to play a role in innate immunity in the cochlea (Jung et al., 2019). Cochlin, and particularly the vWFA domain-containing peptides, are a major component of the cochlear extracellular matrix (Ikezono et al., 2001; Kommareddi et al., 2007; Nagy et al., 2008). The LCCL domain harbors two founder mutations: c.151C>T (p.P51S) in the Dutch/Belgian population, and c.263G>A (p.G88E) in the American population (Robertson et al., 1998; de Kok et al., 1999). Overexpression of cochlin proteins containing these variants in cultured cells revealed that both mutations resulted in the formation of cytotoxic cochlin dimers (Yao et al., 2010). And although both mutations did not affect secretion of cochlin, proteolytic cleavage of cochlin was shown to be impaired by these mutations. These findings indicate that DFNA9 results from a gain-of-function and/or a dominant-negative disease mechanism, rather than from haploinsufficiency. Gene augmentation therapy, which is currently under development for several types of hereditary hearing impairment (Wang et al., 2018), would not be effective, as this does not relieve the inner ear from the formation of cytotoxic cochlin dimers and secretion of unprocessed cochlin proteins. However, prevention of mutant cochlin production has high therapeutic potential. The lack of an auditory and vestibular phenotype in mice carrying a heterozygous null mutation in Coch (Jones et al., 2011), and heterozygous family members of patients suffering from early-onset hearing impairment caused by a homozygous null mutation in COCH, illustrates that sufficient functional cochlin proteins can be produced from a single healthy COCH allele (JanssensdeVarebeke et al., 2018). DNA-based antisense oligonucleotides containing thymine residues instead of uracil residues, have been shown to effectively target (pre)mRNA molecules for degradation by the RNase H1 enzyme (Vickers and Crooke, 2014; Liang et al., 2017). This type of antisense oligonucleotide therapy is currently under development for several types of hereditary disorders, such as Huntington's and cystic fibrosis (Kordasiewicz et al., 2012; Crosby et al., 2017). There are only few reports of therapeutic application of AONs in the inner ear, most of which focus on splice-correction therapy. The fact that a considerable amount of DFNA9 cases carry the c.151C>T or c.263G>A founder mutations renders it an attractive target for antisense oligonucleotide (AON)-based therapy. Accordingly, there is an urge to develop AONs for degradation of the mutated COCH gene to prevent the formation of cytotoxic cochlin dimers in subjects suffering from hearing impairment and/or vestibular dysfunction, and thereby delaying of halting disease progression.
SUMMARY OF THE INVENTION
The invention relates to an antisense oligonucleotide moiety for the specific degradation of a mutated COCH transcript that binds to and/or is complementary to a polynucleotide with the nucleotide sequence as set forward in SEQ ID NO: 1 or in SEQ ID NO: 2, wherein preferably the antisense oligonucleotide moiety binds to or is complementary to a polynucleotide part within SEQ ID NO: 1 or SEQ ID NO: 2, said polynucleotide part having a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, and 26. The invention further relates to a pharmaceutical composition comprising an antisense oligonucleotide for the degradation of a mutated COCH according to the invention and further comprising a pharmaceutically acceptable excipient. In a third aspect, the invention provides for an antisense oligonucleotide for the degradation of a mutated COCH according to the invention or the pharmaceutical composition according to the invention for use as a medicament, preferably for use as a medicament for treating a COCH related disease or a condition requiring the degradation of mutated COCH (pre)mRNA. The invention further relates to the use of the antisense oligonucleotide for the degradation of a mutated COCH according to the invention or the pharmaceutical composition according to the invention, for treating a COCH related disease or a condition requiring the degradation of mutated COCH (pre)mRNA. The invention further relates to a method of treatment of a COCH related disease or condition requiring the degradation of mutated COCH (pre)mRNA in a subject in need thereof, comprising administration of an antisense oligonucleotide for the degradation of a mutated COCH according to the invention or administration of the pharmaceutical composition according to the invention. The invention further relates to a method for the degradation of a mutated COCH in a cell, the method comprising contacting the cell with an antisense oligonucleotide for the degradation of a mutated COCH according to the invention or the pharmaceutical composition according to the invention.
DETAILED DESCRIPTION
OF THE INVENTION By definition, antisense oligonucleotides (AONs) are substantially complementary (i.e. antisense) to their target, allowing them to bind to the corresponding pre-mRNA molecule. On the basis of mechanism of action, two main classes of antisense oligonucleotide can generally be discerned: (a) the RNase H-dependent oligonucleotides, which induce degradation of mRNA; and (b) the steric-blocker oligonucleotides, which physically prevent or inhibit progression of splicing or the translational machinery. The inventors have identified AONs that allow the specific degradation of mutant COCH transcripts that are associated with DFNA9. The prerequisite for an effective AON-based therapy in the treatment of dominantly inherited non-haploinsufficiency disorder is that protein production from the healthy allele remains unaffected. The mutant and healthy cochlin-encoding sequence only differ from each other by a single nucleotide. However, the inventors identified 12 additional low-frequency variants (<0.1 allele frequency in the non-Finnish European population) that are present on the c.151C>T allele of the COCH gene (see table 3 below). These variants offer additional targets for the most optimal discrimination between the mutant and the wildtype allele in the design of a mutant allele-specific, AON-based therapy for DFNA9. No such additional genetic variants were identified for the c.263G>A mutant allele. Accordingly, in a first aspect the invention provides for an antisense oligonucleotide moiety for the specific degradation of a mutated COCH transcript that binds to and/or is complementary to a polynucleotide with the nucleotide sequence as set forward in SEQ ID NO: 1 or in SEQ ID NO: 2. Preferably, the antisense oligonucleotide moiety binds to or is complementary to a polynucleotide part within SEQ ID NO: 1 or SEQ ID NO: 2, said polynucleotide part having a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, and 26. The terms “antisense oligonucleotide” and “AON” are used interchangeably herein and are understood to refer to an oligonucleotide molecule comprising a nucleotide sequence which is substantially complementary to a target nucleotide sequence in a pre-mRNA molecule, hnRNA (heterogenous nuclear RNA) or mRNA molecule. The degree of complementarity (or substantial complementarity) of the antisense sequence is preferably such that a molecule comprising the antisense sequence can form a stable hybrid with the target nucleotide sequence in the RNA molecule under physiological conditions. Binding of an AON to its target can easily be assessed by the person skilled in the art using techniques that are known in the field such as the gel mobility shift assay as described in EP1619249. The term “complementary” used in the context of the invention indicates that some mismatches in the antisense sequence are allowed as long as the functionality, i.e. promoting mRNA degradation is achieved. Preferably, the complementarity is from 90% to 100%. In general this allows for 1 or 2 mismatches in an AON of 20 nucleotides or 1, 2, 3 or 4 mismatches in an AON of 40 nucleotides, or 1, 2, 3, 4, 5 or 6 mismatches in an AON of 60 nucleotides, etc. Optionally, said AON may further be tested by transfection into COCH-expressing T-REx 293 cells or isolated cells from patients having a mutated COCH. The complementary regions are preferably designed such that, when combined, they are specific for the intron or exon in the pre-mRNA or mRNA. Such specificity may be created with various lengths of complementary regions, as this depends on the actual sequences in other (pre-)mRNA molecules in the system. The risk that the AON will also be able to hybridize to one or more other (pre-)mRNA molecules decreases with increasing size of the AON. It is clear that AONs comprising mismatches in the region of complementarity but that retain the capacity to hybridize and/or bind to the targeted region(s) in the (pre-)mRNA, can be used in the invention. However, preferably at least the complementary parts do not comprise such mismatches as AONs lacking mismatches in the complementary part typically have a higher efficiency and a higher specificity than AONs having such mismatches in one or more complementary regions. It is thought, that higher hybridization strengths, (i.e. increasing number of interactions with the opposing strand) are favorable in increasing the efficiency of the process of interfering with the splicing or mRNA degradation machinery of the system. In certain embodiments, the degradation is nuclease degradation (e.g., RNase H). The AON according to the invention preferably does not contain a stretch of CpG, more preferably does not contain any CpG. The presence of a CpG or a stretch of CpG in an oligonucleotide is usually associated with an increased immunogenicity of said oligonucleotide (Dorn and Kippenberger, 2008). This increased immunogenicity is undesired since it may induce damage of the tissue to be treated, i.e. the inner ear. Immunogenicity may be assessed in an animal model by assessing the presence of CD4+ and/or CD8+ cells and/or inflammatory mononucleocyte infiltration. Immunogenicity may also be assessed in blood of an animal or of a human being treated with an AON according to the invention by detecting the presence of a neutralizing antibody and/or an antibody recognizing said AON using a standard immunoassay known to the skilled person. An inflammatory reaction, type I-like interferon production, IL-12 production and/or an increase in immunogenicity may be assessed by detecting the presence or an increasing amount of a neutralizing antibody or an antibody recognizing said AON using a standard immunoassay. The AON according to the invention furthermore preferably has acceptable RNA binding kinetics and/or thermodynamic properties. The RNA binding kinetics and/or thermodynamic properties are at least in part determined by the melting temperature of an oligonucleotide (Tm; calculated with the oligonucleotide properties calculator (www.unc.edu/-cail/biotool/oligo/index) for single stranded RNA using the basic Tm and the nearest neighbor model), and/or the free energy of the AON-target intron/exon complex (using RNA structure version 4.5). If a Tm is too high, the AON is expected to be less specific. An acceptable Tm and free energy depend on the sequence of the AON. Therefore, it is difficult to give preferred ranges for each of these parameters. An acceptable Tm may be ranged between 35 and 70° C. and an acceptable free energy may be ranged between 15 and 45 kcal/mol. In all embodiments, the nucleotide in the antisense oligonucleotide according to the invention may be, wherein a nucleotide in the antisense oligonucleotide may be an RNA residue, a DNA residue, and/or a nucleotide analogue or equivalent. Preferably, the antisense oligonucleotide comprises both RNA and DNA residues. More preferably, the antisense oligonucleotide as described herein is a GapmeR. “GapmeR” or “gap oligomer”, as used herein, refers to a chimeric oligomer having a central portion (a “gap”) flanked by 3′ and 5′ “wings”, wherein the gap has a modification that is different as compared to each of the wings. Such modifications may include nucleobase, monomeric linkage, and sugar modifications as well as the absence of a modification (such as unmodified RNA or DNA). Accordingly, a gapmer may be as simple as RNA wings separated by a DNA gap. In some cases, the nucleotide linkages in the wings may be different than the nucleotide linkages in the gap. In certain embodiments, each wing comprises nucleotides with high affinity modifications and the gap comprises nucleotides that do not comprise that modification. Alternatively, the nucleotides in the gap and the nucleotides in the wings may have high affinity modifications, but the high affinity modifications in the gap are different than the high affinity modifications in each of the wings. The modifications in the wings may confer resistance to cleavage by endogenous nucleases, including RNaseH, while the modifications in the gap may be substrates for RNase H. The modifications in the wings may confer resistance to cleavage by endogenous nucleases, including RNaseH, while the modifications in the gap maybe substrates for RNase H. The modifications in the wings may be the same or different from one another. The nucleotides in the gap may be unmodified and nucleotides in the wings may be modified. A GapmeR has a wing-gap-wing ratio, which may be represented numerically (wing #-gap #-wing #). The GapmeR may be symmetrical for example 7-12-7, 7-11-7, 7-10-7, 7-9-7, 7-8-7, 7-7-7, 7-6-7, 7-5-7, 7-4-7, 7-3-7, 6-12-6, 6-11-6, 6-10-6, 6-9-6, 6-8-6, 6-7-6, 6-6-6, 6-5-6, 6-4-6, 6-3-6, 6-2-6, 5-12-5, 5-11-5, 5-10-5, 5-9-5, 5-8-5, 5-7-5, 5-6-5, 5-5-5, 5-4-5, 5-3-5, 4-12-4, 4-11-4, 4-10-4, 4-9-4, 4-8-4, 4-7-4, 4-6-4, 4-5-4, 4-4-4, 4-3-4, 3-12-3, 3-11-3, 3-10-3, 3-9-3, 3-8-3, 3-7-3, 3-6-3, 3-5-3, or 3-4-3. In one embodiment, the Gapmer may be asymmetrical for example, 8-13-9, 8-12-9, 8-11-9, 8-10-9, 8-9-9, 8-8-9, 8-7-9, 8-6-9, 8-5-9, 8-4-9, 8-3-9, 8-2-9, 8-1-9, 7-15-8, 7-14-8, 7-13-8, 7-12-8, 7-11-8, 7-10-8, 7-9-8, 7-8-8, 7-7-8, 7-6-8, 7-5-8, 7-4-8, 7-3-8, 7-2-8, 7-1-8, 6-15-7, 6-14-7, 6-13-7, 6-12-7, 6-11-7, 6-10-7, 6-9-7, 6-8-7, 6-7-7, 6-6-7, 6-5-7, 6-4-7, 6-3-7, 6-2-7, 6-1-7, 5-15-6, 5-14-6, 5-13-6, 5-12-6, 5-11-6, 5-10-6, 5-9-6, 5-8-6, 5-7-6, 5-6-6, 5-5-6, 5-4-6, 5-3-6, 5-2-6, 5-1-6, 4-15-5, 4-14-5, 4-13-5, 4-13-3, 4-12-5, 4-11-5, 4-10-5, 4-9-5, 4-8-5, 4-7-5, 4-6-5, 4-5-5, 4-4-5, 4-3-5, 4-2-5, 4-1-5, 3-17-4, 3-16-4, 3-15-4, 3-14-4, 3-13-4, 3-12-4, 3-11-4, 3-10-4, 3-9-4, 3-8-4, 3-7-4, 3-6-4, 3-5-4, 3-4-4, 3-3-4, 2-24-3, 2-23-3, 2-22-3, 2-21-3, 2-20-3, 2-19-3, 2-18-3, 2-17-3, 2-16-3, 2-15-3, 2-14-3, 2-13-3, 2-12-3, 2-11-3, 2-10-3, 2-9-3, 2-8-3, 2-7-3, 2-6-3, 2-5-3, 2-4-3, 1-26-2, 1-25-2, 1-24-2, 1-22-2, 1-21-2, 1-20-2, 1-19-2, 1-18-2, 1-17-2, 1-16-2, 1-15-2, 1-14-2, 1-13-2, 1-12-2, 1-11-2, 1-10-2, 1-9-2, 1-8-2, 1-7-2, 3-26-1, 3-5-1, 3-24-1, 3-22-1, 3-21-1, 3-20-1, 3-19-1, 3-18-1, 3-17-1, 3-16-1, 3-15-1, 3-14-1, 4-13-1, 4-12-1, 4-11-1, 4-10-1, 3-9-1, 3-8-1 or 4-7-1. A preferred AON for the degradation of a mutated COCH according to the invention, has a length of from about 8 to about 40 nucleotides, preferably from about 10 to about 40 nucleotides, more preferably from about 14 to about 30 nucleotides, more preferably from about 16 to about 24 nucleotides, such as 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides. Preferably, an AON according to the invention has a length of at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides. Most preferably, the AON has a length of about 20 nucleotides. A preferred AON for the degradation of a mutated COCH according to the invention comprises or consists of an oligonucleotide with the sequence as set forward in SEQ ID NO: 27, 28, 29, 30, 31, 32, 33, 34, 35, 50, 53, 54, 55, 56, or 57. In an embodiment, the AON as described herein is complementary to a polynucleotide with the nucleotide sequence as set forward in SEQ ID NO: 3 and the preferred AONs comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 27, 28, 29, 30, 31, 33, and 34. In an embodiment, the AON as described herein is complementary to a polynucleotide with the nucleotide sequence as set forward in SEQ ID NO: 4 and the preferred AONs comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 27, 28, 29, 30, 31, 33, and 34. In an embodiment, the AON as described herein is complementary to a polynucleotide with the nucleotide sequence as set forward in SEQ ID NO: 5 and the preferred AONs comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 27, 28, 29, 30, 31, 33, and 34. In an embodiment, the AON as described herein is complementary to a polynucleotide with the nucleotide sequence as set forward in any one of SEQ ID NO: 12, 13 and 14 and the preferred AONs comprise or consist of a sequence selected from SEQ ID NO: 35 and 50. In an embodiment, the AON as described herein is complementary to a polynucleotide with the nucleotide sequence as set forward in any one of SEQ ID NO: 24, 25 and 26 and the preferred AONs comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 53, 54, 55, 56 and 57, preferably the AON comprise or consist sequence SEQ ID NO: 53 or SEQ ID NO: 56. It is preferred that an AON for the degradation of a mutated COCH according to the invention comprises one or more residues that are modified to increase nuclease resistance, and/or to increase the affinity of the antisense oligonucleotide for the target sequence. Therefore, in a preferred embodiment, the AON comprises at least one nucleotide analogue or equivalent, wherein a nucleotide analogue or equivalent is defined as a residue having a modified base, and/or a modified backbone, and/or a non-natural internucleoside linkage, or a combination of these modifications. In a preferred embodiment, the nucleotide analogue or equivalent comprises a modified backbone. Examples of such backbones are provided by morpholino backbones, carbamate backbones, siloxane backbones, sulfide, sulfoxide and sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl backbones, riboacetyl backbones, alkene containing backbones, sulfamate, sulfonate and sulfonamide backbones, methyleneimino and methylenehydrazino backbones, and amide backbones. Phosphorodiamidate morpholino oligomers are modified backbone oligonucleotides that have previously been investigated as antisense agents. Most preferably, the AON according to the invention comprises a phosphorothiorate backbone. Morpholino oligonucleotides have an uncharged backbone in which the deoxyribose sugar of DNA is replaced by a six membered ring and the phosphodiester linkage is replaced by a phosphorodiamidate linkage. Morpholino oligonucleotides are resistant to enzymatic degradation and appear to function as antisense agents by arresting translation or interfering with pre-mRNA splicing rather than by activating RNase H. Morpholino oligonucleotides have been successfully delivered to tissue culture cells by methods that physically disrupt the cell membrane, and one study comparing several of these methods found that scrape loading was the most efficient method of delivery; however, because the morpholino backbone is uncharged, cationic lipids are not effective mediators of morpholino oligonucleotide uptake in cells. A recent report, demonstrated triplex formation by a morpholino oligonucleotide and, because of the non-ionic backbone, these studies showed that the morpholino oligonucleotide was capable of triplex formation in the absence of magnesium. It is further preferred that the linkage between the residues in a backbone do not include a phosphorus atom, such as a linkage that is formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. A preferred nucleotide analogue or equivalent comprises a Peptide Nucleic Acid (PNA), having a modified polyamide backbone (Nielsen et al., 1991). PNA-based molecules are true mimics of DNA molecules in terms of base-pair recognition. The backbone of the PNA is composed of N-(2-aminoethyl)-glycine units linked by peptide bonds, wherein the nucleobases are linked to the backbone by methylene carbonyl bonds. An alternative backbone comprises a one-carbon extended pyrrolidine PNA monomer (Govindaraju and Kumar, 2005). Since the backbone of a PNA molecule contains no charged phosphate groups, PNA-RNA hybrids are usually more stable than RNA-RNA or RNA-DNA hybrids, respectively (Egholm et al., 1993). A further preferred backbone comprises a morpholino nucleotide analog or equivalent, in which the ribose or deoxyribose sugar is replaced by a 6-membered morpholino ring. A most preferred nucleotide analog or equivalent comprises a phosphorodiamidate morpholino oligomer (PMO), in which the ribose or deoxyribose sugar is replaced by a 6-membered morpholino ring, and the anionic phosphodiester linkage between adjacent morpholino rings is replaced by a non-ionic phosphorodiamidate linkage. In yet a further embodiment, a nucleotide analogue or equivalent according to the invention comprises a substitution of one of the non-bridging oxygens in the phosphodiester linkage. This modification slightly destabilizes base-pairing but adds significant resistance to nuclease degradation. A preferred nucleotide analogue or equivalent comprises phosphorothioate, chiral phosphorothioate, phosphorodithioate, phosphotriester, aminoalkylphosphotriester, H-phosphonate, methyl and other alkyl phosphonate including 3′-alkylene phosphonate, 5′-alkylene phosphonate and chiral phosphonate, phosphinate, phosphoramidate including 3′-amino phosphoramidate and aminoalkylphosphoramidate, thionophosphoramidate, thionoalkylphosphonate, thionoalkylphosphotriester, selenophosphate or boranophosphate. A further preferred nucleotide analogue or equivalent according to the invention comprises one or more sugar moieties that are mono- or disubstituted at the 2′, 3′ and/or 5′ position such as a —OH; —F; substituted or unsubstituted, linear or branched lower (CI-C10) alkyl, alkenyl, alkynyl, alkaryl, allyl, or aralkyl, that may be interrupted by one or more heteroatoms; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; O-, S-, or N-allyl; O-alkyl-O-alkyl, -methoxy, -aminopropoxy; methoxyethoxy; dimethylaminooxyethoxy; and -dimethylaminoethoxyethoxy. The sugar moiety can be a pyranose or derivative thereof, or a deoxypyranose or derivative thereof, preferably ribose or derivative thereof, or deoxyribose or derivative of. A preferred derivatized sugar moiety comprises a Locked Nucleic Acid (LNA), in which the 2′-carbon atom is linked to the 3′ or 4′ carbon atom of the sugar ring thereby forming a bicyclic sugar moiety. A preferred LNA comprises 2′-O, 4′-C-ethylene-bridged nucleic acid (Morita et al., 2001). These substitutions render the nucleotide analogue or equivalent RNase H and nuclease resistant and increase the affinity for the target RNA. In another embodiment, a nucleotide analogue or equivalent according to the invention comprises one or more base modifications or substitutions. Modified bases comprise synthetic and natural bases such as inosine, xanthine, hypoxanthine and other -aza, deaza, -hydroxy, -halo, -thio, thiol, -alkyl, -alkenyl, -alkynyl, thioalkyl derivatives of pyrimidine and purine bases that are or will be known in the art. It is understood by a skilled person that it is not necessary for all positions in an AON to be modified uniformly. In addition, more than one of the aforementioned analogues or equivalents may be incorporated in a single AON or even at a single position within an AON. In certain embodiments, an AON according to the invention has at least two different types of analogues or equivalents. Accordingly, in a preferred embodiment an antisense oligonucleotide for the degradation of a mutated COCH according to the invention, comprises a 2′-O alkyl phosphorothioate antisense oligonucleotide, such as 2′-O-methyl modified ribose (RNA), 2′-O-ethyl modified ribose, 2′-O-propyl modified ribose, and/or substituted derivatives of these modifications such as halogenated derivatives. Preferably, when the AONs according to the invention is a gapmer, the gapmer is modified to comprise a phosphorothioate backbone and a 2′-O-methyl modified ribose. It will also be understood by a skilled person that different antisense oligonucleotides can be combined for the specific degradation of a mutated COCH. Accordingly, the invention provides for a set of antisense oligonucleotide for promoting specific degradation of COCH comprising at least two antisense oligonucleotides as defined herein. An AON for the specific degradation of a mutated COCH to the invention may be indirectly administrated using suitable means known in the art. It may for example be provided to an individual or a cell, tissue or organ of said individual as such, as a so-called ‘naked’ AON. It may also be administered in the form of an expression vector wherein the expression vector encodes an RNA transcript comprising the sequence of said AON according to the invention. The expression vector is preferably introduced into a cell, tissue, organ or individual via a gene delivery vehicle. In a preferred embodiment, when the AON comprises or consists of unmodified RNA residues, there is provided a viral-based expression vector comprising an expression cassette or a transcription cassette that drives expression or transcription of an AON according to the invention. Accordingly, the invention provides for a viral vector expressing antisense oligonucleotide according to the invention when placed under conditions conducive to expression of the antisense oligonucleotide. A cell can be provided with an AON for the specific degradation of a mutated COCH to the invention by plasmid-derived antisense oligonucleotide expression or viral expression provided by adenovirus- or adeno-associated virus-based vectors. Expression may be driven by an RNA polymerase II promoter (Pol II) such as a U7 RNA promoter or an RNA polymerase III (Pol III) promoter, such as a U6 RNA promoter. A preferred delivery vehicle is a viral vector such as an adeno-associated virus vector (AAV), or a retroviral vector such as a lentivirus vector and the like. Also, plasmids, artificial chromosomes, plasmids usable for targeted homologous recombination and integration in the human genome of cells may be suitably applied for delivery of an AON according to the invention. Preferred for the invention are those vectors wherein transcription is driven from PolIII promoters, and/or wherein transcripts are in the form fusions with U1 or U7 transcripts, which yield good results for delivering small transcripts. It is within the skill of the artisan to design suitable transcripts. Preferred are PolIII driven transcripts, preferably, in the form of a fusion transcript with an U1 or U7 transcript. Such fusions may be generated as previously described (Gorman et al., 1998). A preferred expression system for an AON for specific degradation of a mutated COCH according to the invention is an adenovirus associated virus (AAV)-based vector. Single chain and double chain AAV-based vectors have been developed that can be used for prolonged expression of antisense nucleotide sequences for highly efficient degradation of transcripts. A preferred AAV-based vector, for instance, comprises an expression cassette that is driven by an RNA polymerase III-promoter (Pol III) or an RNA polymerase II promoter (Pol II). A preferred RNA promoter is, for example, a Pol III U6 RNA promoter, or a Pol II U7 RNA promoter. The invention accordingly provides for a viral-based vector, comprising a Pol II or a Pol III promoter driven expression cassette for expression of an AON for the specific degradation of a mutated COCH according to the invention. An AAV vector according to the invention is a recombinant AAV vector and refers to an AAV vector comprising part of an AAV genome comprising an encoded AON for the specific degradation of a mutated COCH according to the invention encapsidated in a protein shell of capsid protein derived from an AAV serotype as depicted elsewhere herein. Part of an AAV genome may contain the inverted terminal repeats (ITR) derived from an adeno-associated virus serotype, such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV8, AAV9 and others. A protein shell comprised of capsid protein may be derived from an AAV serotype such as AAV1, 2, 3, 4, 5, 8, 9 and others. A protein shell may also be named a capsid protein shell. AAV vector may have one or preferably all wild type AAV genes deleted, but may still comprise functional ITR nucleic acid sequences. Functional ITR sequences are necessary for the replication, rescue and packaging of AAV virions. The ITR sequences may be wild type sequences or may have at least 80%, 85%, 90%, 95, or 100% sequence identity with wild type sequences or may be altered by for example in insertion, mutation, deletion or substitution of nucleotides, as long as they remain functional. In this context, functionality refers to the ability to direct packaging of the genome into the capsid shell and then allow for expression in the host cell to be infected or target cell. In the context of the invention a capsid protein shell may be of a different serotype than the AAV vector genome ITR. An AAV vector according to present the invention may thus be composed of a capsid protein shell, i.e. the icosahedral capsid, which comprises capsid proteins (VP1, VP2, and/or VP3) of one AAV serotype, e.g. AAV serotype 2, whereas the ITRs sequences contained in that AAV5 vector may be any of the AAV serotypes described above, including an AAV2 vector. An “AAV2 vector” thus comprises a capsid protein shell of AAV serotype 2, while e.g. an “AAV5 vector” comprises a capsid protein shell of AAV serotype 5, whereby either may encapsidate any AAV vector genome ITR according to the invention. Preferably, a recombinant AAV vector according to the invention comprises a capsid protein shell of AAV serotype 2, 5, 8 or AAV serotype 9 wherein the AAV genome or ITRs present in said AAV vector are derived from AAV serotype 2, 5, 8 or AAV serotype 9; such AAV vector is referred to as an AAV2/2, AAV 2/5, AAV2/8, AAV2/9, AAV5/2, AAV5/5, AAV5/8, AAV 5/9, AAV8/2, AAV 8/5, AAV8/8, AAV8/9, AAV9/2, AAV9/5, AAV9/8, or an AAV9/9 vector. More preferably, a recombinant AAV vector according to the invention comprises a capsid protein shell of AAV serotype 2 and the AAV genome or ITRs present in said vector are derived from AAV serotype 5; such vector is referred to as an AAV 2/5 vector. More preferably, a recombinant AAV vector according to the invention comprises a capsid protein shell of AAV serotype 2 and the AAV genome or ITRs present in said vector are derived from AAV serotype 8; such vector is referred to as an AAV 2/8 vector. More preferably, a recombinant AAV vector according to the invention comprises a capsid protein shell of AAV serotype 2 and the AAV genome or ITRs present in said vector are derived from AAV serotype 9; such vector is referred to as an AAV 2/9 vector. More preferably, a recombinant AAV vector according to the invention comprises a capsid protein shell of AAV serotype 2 and the AAV genome or ITRs present in said vector are derived from AAV serotype 2; such vector is referred to as an AAV 2/2 vector. A nucleic acid molecule encoding an AON according to the invention represented by a nucleic acid sequence of choice is preferably inserted between the AAV genome or ITR sequences as identified above, for example an expression construct comprising an expression regulatory element operably linked to a coding sequence and a 3′ termination sequence. “AAV helper functions” generally refers to the corresponding AAV functions required for AAV replication and packaging supplied to the AAV vector in trans. AAV helper functions complement the AAV functions which are missing in the AAV vector, but they lack AAV ITRs (which are provided by the AAV vector genome). AAV helper functions include the two major ORFs of AAV, namely the rep coding region and the cap coding region or functional substantially identical sequences thereof. Rep and Cap regions are well known in the art, see e.g. (Chiorini et al., 1999) or U.S. Pat. No. 5,139,941, incorporated herein by reference. The AAV helper functions can be supplied on an AAV helper construct, which may be a plasmid. Introduction of the helper construct into the host cell can occur e.g. by transformation, transfection, or transduction prior to or concurrently with the introduction of the AAV genome present in the AAV vector as identified herein. The AAV helper constructs according to the invention may thus be chosen such that they produce the desired combination of serotypes for the AAV vector's capsid protein shell on the one hand and for the AAV genome present in said AAV vector replication and packaging on the other hand. “AAV helper virus” provides additional functions required for AAV replication and packaging. Suitable AAV helper viruses include adenoviruses, herpes simplex viruses (such as HSV types 1 and 2) and vaccinia viruses. The additional functions provided by the helper virus can also be introduced into the host cell via vectors, as described in U.S. Pat. No. 6,531,456 incorporated herein by reference. Preferably, an AAV genome as present in a recombinant AAV vector according to the invention does not comprise any nucleotide sequences encoding viral proteins, such as the rep (replication) or cap (capsid) genes of AAV. An AAV genome may further comprise a marker or reporter gene, such as a gene for example encoding an antibiotic resistance gene, a fluorescent protein (e.g. gfp) or a gene encoding a chemically, enzymatically or otherwise detectable and/or selectable product (e.g. lacZ, aph, etc.) known in the art. A preferred AAV vector according to the invention is an AAV vector, preferably an AAV2/5, AAV2/8, AAV2/9 or AAV2/2 vector, carrying an AON for promoting mRNA degradation according to the invention that is an AON that comprises, or preferably consists of, a sequence that is: complementary or substantially complementary to a nucleotide sequence consisting of SEQ ID NO 1 or SEQ ID NO: 2, preferably the antisense oligonucleotide moiety binds to or is complementary to a polynucleotide part within SEQ ID NO: 1 or SEQ ID NO: 2 with a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26. Even more preferably, the AON comprises or consists of a polynucleotide with a nucleotide sequence selected from the group consisting of SEQ ID NO: 27, 28, 29, 30, 31, 32, 33, 34, 35, 50, 53, 54, 55, 56 and 57. Improvements in means for providing an individual or a cell, tissue, organ of said individual with an AON for promoting the degradation of mutated COCH mRNA according to the invention, are anticipated considering the progress that has already thus far been achieved. Such future improvements may of course be incorporated to achieve the mentioned effect on restructuring of mRNA using a method according to the invention. Alternatively, a preferred delivery method for an AON the specific degradation of a mutated COCH as described herein or a plasmid for expression of such AON is a viral vector or are nanoparticles. Alternatively, a plasmid can be provided by transfection using known transfection agents. For intravenous, subcutaneous, intratympanic, nasal, intramuscular, intrathecal and/or intraventricular administration it is preferred that the solution is a physiological salt solution. Particularly preferred in the invention is the use of an excipient or transfection agents that will aid in delivery of each of the constituents as defined herein to a cell and/or into a cell, preferably a cell expressing the mutated COCH. Preferred are excipients or transfection agents capable of forming complexes, nanoparticles, micelles, vesicles and/or liposomes that deliver each constituent as defined herein, complexed or trapped in a vesicle or liposome through a cell membrane. Many of these excipients are known in the art. Suitable excipients or transfection agentia comprise polyethylenimine (PEI; ExGen500 (MBI Fermentas)), LipofectAMINE™ 2000 (Invitrogen) or derivatives thereof, or similar cationic polymers, including polypropyleneimine or polyethylenimine copolymers (PECs) and derivatives, synthetic amphiphils (SAINT-18), Lipofectin™, DOTAP and/or viral capsid proteins that are capable of self-assembly into particles that can deliver each constituent as defined herein to a cell, preferably a cell that expresses mutated COCH. Such excipients have been shown to efficiently deliver an oligonucleotide such as AONs to a wide variety of cultured cells in vitro, including COCH-expressing T-REx 293 cells. The ease of structural modification can be used to allow further modifications and the analysis of their further (in vivo) nucleic acid transfer characteristics and toxicity. Lipofectin represents an example of a liposomal transfection agent. It consists of two lipid components, a cationic lipid N-[1-(2,3 dioleoyloxy)propyl]-N, N, N-trimethylammonium chloride (DOTMA) (cp. DOTAP which is the methylsulfate salt) and a neutral lipid dioleoylphosphatidylethanolamine (DOPE). The neutral component mediates the intracellular release. Another group of delivery systems are polymeric nanoparticles. Polycations such as diethylaminoethylaminoethyl (DEAE)-dextran, which are well known as DNA transfection reagent can be combined with butylcyanoacrylate (PBCA) and hexylcyanoacrylate (PHCA) to formulate cationic nanoparticles that can deliver each constituent as defined herein, preferably an AON according to the invention, across cell membranes into cells. In addition to these common nanoparticle materials, the cationic peptide protamine offers an alternative approach to formulate an oligonucleotide with colloids. This colloidal nanoparticle system can form so called proticles, which can be prepared by a simple self-assembly process to package and mediate intracellular release of an oligonucleotide. The skilled person may select and adapt any of the above or other commercially available alternative excipients and delivery systems to package and deliver an AON for use in the current invention to deliver it for the prevention, treatment or delay of a COCH related disease or a condition requiring the degradation of mutated COCH (pre)mRNA. “Prevention, treatment or delay of an COCH related disease or a condition related disease or condition” is herein preferably defined as preventing, halting, ceasing the progression of, or (partially) reversing the formation of cytotoxic cochlin dimers. In addition, an AON according to the invention could be covalently or non-covalently linked to a targeting ligand specifically designed to facilitate the uptake into the cell, cytoplasm and/or its nucleus. Such ligand could comprise (i) a compound (including but not limited to peptide(-like) structures) recognizing cell, tissue or organ specific elements facilitating cellular uptake and/or (ii) a chemical compound able to facilitate the uptake in to cells and/or the intracellular release of an oligonucleotide from vesicles, e.g. endosomes or lysosomes. Therefore, in a preferred embodiment, an AON for the degradation of a mutated COCH transcript according to the invention is formulated in a composition or a medicament or a composition, which is provided with at least an excipient and/or a targeting ligand for delivery and/or a delivery device thereof to a cell and/or enhancing its intracellular delivery. It is to be understood that if a composition comprises an additional constituent such as an adjunct compound as later defined herein, each constituent of the composition may not be suitably formulated in one single combination or composition or preparation. Depending on their identity and specific features, the skilled person will know which type of formulation is the most appropriate for each constituent as defined herein. In a preferred embodiment, the invention provides a composition or a preparation which is in the form of a kit of parts comprising an AON for the degradation of a mutated COCH according to the invention and a further adjunct compound as later defined herein. If required and/or if desired, an AON for the degradation of a mutated COCH transcript, a set of antisense oligonucleotides according to the invention, or a vector, preferably a viral vector, according to the invention, carrying naked AONs or expressing an AON for degrading the mutated COCH transcript according to the invention can be incorporated into a pharmaceutically active mixture by adding a pharmaceutically acceptable carrier. Accordingly, the invention also provides for a composition, preferably a pharmaceutical composition comprising an antisense oligonucleotide for the specific degradation of a mutated COCH transcript, according to the invention and a pharmaceutically acceptable excipient. Such composition may comprise a single AON for degrading mutated COCH transcripts according to the invention, but may also comprise multiple, distinct AONs as described herein. Such a pharmaceutical composition may comprise any pharmaceutically acceptable excipient, including a carrier, filler, preservative, adjuvant, solubilizer and/or diluent. Such pharmaceutically acceptable carrier, filler, preservative, adjuvant, solubilizer and/or diluent may for instance be found in Remington, 2000. Each feature of said composition has earlier been defined herein. A preferred route of administration is administration into the inner ear (intratympanic). More preferred is administration into the cochlea and/or into the vestibular organ. In one embodiment, the route of administration is nasal delivery. A preferred AON for the specific degradation of a mutated COCH transcript according to the invention, is for the treatment of an COCH related disease or condition of an individual. In all embodiments of the invention, the term “treatment” is understood to include the prevention and/or delay of the COCH related disease or a condition requiring degradation of the (pre)-mRNA of COCH or promoting degradation of mutated COCH mRNA. An individual, which may be treated using an AON according to the invention may already have been diagnosed as having an COCH-related disease or condition, such as DFNA9. Alternatively, an individual which may be treated using an AON according to the invention may not have yet been clinically diagnosed as having a COCH-related disease or condition requiring the degradation of COCH but may be an individual having an increased risk of developing a COCH-related disease or condition, such as DFNA9 in the future given his or her genetic background. A preferred individual is a human being. In all embodiments of the invention, the COCH-related disease or condition preferably is a condition resulting in hearing impairment and/or vestibular dysfunction, preferably wherein the condition is a vestibulo-cochlear disorder, more preferably wherein the disease or condition is DFNA9. Accordingly, the invention further provides for an antisense oligonucleotide according to the invention, a set of antisense oligonucleotides according to the invention, or a viral vector according to the invention, or a (pharmaceutical) composition according to the invention for use as a medicament, preferably as a medicament for the treatment of an COCH-related disease or condition requiring the degradation of a mutated COCH and for use as a medicament for the prevention, treatment or delay of an COCH-related disease or condition requiring degradation of a mutated COCH transcript. Each feature of all medical use embodiment herein has earlier been defined herein and is preferably such feature as earlier defined herein. The invention further provides for the use of an AON to the invention, a set of antisense oligonucleotides according to the invention, a vector according to the invention or a (pharmaceutical) composition according to the invention for treating an COCH-related disease or condition requiring the degradation of mutated COCH transcript. Each feature of all medical use embodiment herein has earlier been defined herein and is preferably such feature as earlier defined herein. The invention further provides for, a method of treatment of an COCH-related disease or condition requiring degradation of a mutated COCH transcript, said method comprising contacting a cell of said individual with an AON as described herein, a vector according as described herein or a (pharmaceutical) composition as described herein. Each feature of all medical use embodiment herein has earlier been defined herein and is preferably such feature as earlier defined herein. The invention further provides for the use of an AON as described herein, a set of antisense oligonucleotides according to the invention, a vector according to the invention or a (pharmaceutical) composition according to the invention for the preparation of a medicament for the treatment of an COCH-related disease or condition requiring the specific degradation of COCH transcripts. Each feature of all medical use embodiment herein has earlier been defined herein and is preferably such feature as earlier defined herein. The invention further provides for an antisense oligonucleotide as described herein, a set of antisense oligonucleotides as described herein, the use as described herein or the method according as described herein, wherein the COCH related disease or condition requiring degradation of a mutated COCH is a condition resulting in hearing impairment and/or vestibular dysfunction, preferably wherein the condition is a vestibulo-cochlear disorder, more preferably wherein the disease or condition is DFNA9. Treatment in a use or in a method according to the invention is preferably at least once, and preferably lasts at least one week, one month, several months, one year, 2, 3, 4, 5, 6 years or longer, such as life-long. Each AON as defined herein for use according to the invention may be suitable for direct administration to a cell, tissue and/or an organ in vivo of individuals already affected or at risk of developing an COCH related disease or condition requiring degradation of mutated COCH transcripts, such as vestibulo-cochlear disorder or DFNA9, and may be administered directly in vivo, ex vivo or in vitro. The frequency of administration of an AON, composition, compound or adjunct compound according to the invention may depend on several parameters such as the severity of the disease, the age of the patient, the mutation of the patient, the number of AON according to the invention (i.e. dose), the formulation of the AON, composition, stability of the AON, binding affinity of the AON to the target, compound or adjunct compound according to the invention, the route of administration and so forth. The frequency of administration may vary between daily, weekly, at least once in two weeks, or three weeks or four weeks or five weeks or a longer time period. Dose ranges of an AON, composition, compound or adjunct compound according to the invention are preferably designed on the basis of rising dose studies in clinical trials (in vivo use) for which rigorous protocol requirements exist. An AON according to the invention may be used at a dose which is ranged from 0.01 and 20 mg/kg, preferably from 0.05 and 20 mg/kg. In a preferred embodiment, a viral vector, preferably an AAV vector as described earlier herein, as delivery vehicle for an AON according to the invention, is administered in a dose ranging from 1×1 09 -1×10 17 virus particles per injection, more preferably from 1×10 10 -1×10 12 virus particles per injection. The ranges of concentration or dose of AONs as depicted above are preferred concentrations or doses for in vivo, in vitro or ex vivo uses. The skilled person will understand that depending on the AONs used, the target cell to be treated, the gene target and its expression levels, the medium used and the transfection and incubation conditions, the concentration or dose of AONs used may further vary and may need to be optimized any further. An AON according to the invention, a set of antisense oligonucleotides according to the invention, or a viral vector according to the invention, or a composition according to the invention for use according to the invention may be administered to a cell, tissue and/or an organ in vivo of individuals already affected or at risk of developing a COCH related disease or a condition requiring degradation of mutated COCH transcripts, and may be administered in vivo, ex vivo or in vitro. An AON according to the invention, or a viral vector according to the invention, or a composition according to the invention may be directly or indirectly administered to a cell, tissue and/or an organ in vivo of an individual already affected by or at risk of developing a COCH related disease and may be administered directly or indirectly in vivo, ex vivo or in vitro. The invention further provides for a method for degrading mutated COCH transcripts in a cell, said method comprising contacting the cell, preferably a cell expressing mutated COCH, with an antisense oligonucleotide according to the invention, a set of antisense oligonucleotides according to the invention, the vector according to the invention or the pharmaceutical composition according to the invention. The features of this aspect are preferably those defined earlier herein. Contacting the cell with an AON according to the invention, a set of antisense oligonucleotides according to the invention, or a viral vector according to the invention, or a composition according to the invention may be performed by any method known by the person skilled in the art. Use of the methods for delivery of AONs viral vectors and compositions as described earlier herein is included. Contacting may be directly or indirectly and may be in vivo, ex vivo or in vitro. Unless otherwise indicated each embodiment as described herein may be combined with another embodiment as described herein. Definitions In this document and in its claims, the verb “to comprise” and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition, reference to an element by the indefinite article “a” or “an” does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article “a” or “an” thus usually means “at least one”. The word “about” or “approximately” when used in association with a numerical value (e.g. about 10) preferably means that the value may be the given value (of 10) more or less 5% of the value. The sequence information as provided herein should not be so narrowly construed as to require inclusion of erroneously identified bases. The skilled person is capable of identifying such erroneously identified bases and knows how to correct for such errors. All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety. DESCRIPTION OF THE FIGURES FIG. 1 : Schematic representation of the mutant-allele COCH haplotype analysis. A) A) Low frequency (<0.1 allele frequency) variants on the c.151C>T (p.P51S) haplotype. The 6 variants in intron 7 are c.629+1186T>C, c.629+1779delC, c.629+1807delA, c.629+1809A>C, c.629+1812A>T and c.630-208A>C. B) Low frequency (<0.1 allele frequency) variants on the c.263G>A (p.G88E) haplotype. FIG. 2 : Screening of different AON sequences that reduce the level of c.151C>T mutant COCH transcripts. A) Left panel: Relative mutant COCH expression levels after treatment with AONs complementary to c.151C>T mutation and surrounding sequence in COCH. Right panel: Relative mutant COCH expression levels after treatment with AON_X3a, complementary to the c.436+368_436+369 dupAG variant and surrounding sequence on the c.151C>T allele. All AONs were delivered in a 250 nM concentration. COCH expression is shown relative to the expression of the housekeeping gene RPS18. B) Relative mutant COCH expression levels after treatment with AONs complementary to c.436+368_436+369 dupAG variant and surrounding region, which is located on the c.151C>T mutant COCH allele. All AONs were delivered at a concentration of 250 nM. COCH expression is shown relative to the expression of the housekeeping gene RPS18. FIG. 3 : Concentration series of identified effective AONs. A) AONs were delivered in two (X1b, left panel) or three (X1e (middle panel) and X3a (right panel)) different concentrations. A significant reduction in COCH transcript levels was observed upon transfection of AON_X1b and X1e as compared to untransfected controls. Bars represent the mean mutant COCH expression relative to RPS18. **P<0.01, ***P<0.001, One-Way ANOVA with Tukey's multiple comparison test. B) Gapmer compositions of AONs X1e (left panel), X1f (middle panel) and X3a (right panel) were delivered in three different concentrations. A significant reduction in COCH transcript levels was observed upon transfection of all three AONs in gapmer composition as compared to untransfected controls. Bars represent the mean mutant COCH expression relative to RPS18. **P<0.01, ***P<0.001, One-Way ANOVA with Tukey's multiple comparison test. FIG. 4 : AON treatment of mutant and wildtype COCH-expressing T-REx 293 cells. A) AON treatment of mutant COCH expressing cells results in a significant reduction of mutant COCH transcripts. No difference in effect size is observed after supplementing cells with AON_X1b (targeting the region containing the c.151C>T mutation (white bar)) or AON_X3a (targeting the region containing the c.436+368_436+369 dupAG variant (grey bar)), both residing on the same allele. B) AON treatment of wildtype COCH-expressing cells shows that both the AON_X1b and AON_X3a do not affect wildtype COCH transcript levels. Both graphs depict the result of 3 replicate experiments (N=7-11 measurements). ***P<0.001, One-Way ANOVA with Tukey's multiple comparison test. FIG. 5 : AON treatment of mutant and wildtype COCH-expressing T-REx 293 cells with continuous induction of COCH expression. A) AON treatment of mutant COCH expressing cells with gapmer AONs X1e, X1f and X3a results in a significant reduction of mutant COCH transcripts. B) AON treatment of wildtype COCH-expressing cells shows that none of the four AONs affect wildtype COCH transcript levels. Bars represent the average of 3 replicates, *P 0.05, **P 0.01, ***P<0.001, One-Way ANOVA with Tukey's multiple comparison test. FIG. 6 . AON treatment of HEK-293T cells transiently transfected with c.263G>A mutant COCH plasmids. AON_X4a treatment of c.263G>A mutant COCH expressing cells, resulting from a transient transfection, resulted a significant decrease in mutant COCH transcripts at both 100 nM and 250 nM concentrations. Bars represent the average of 3-6 replicates, **P 0.01, ***P<0.001, One-Way ANOVA with Tukey's multiple comparison test. DESCRIPTION OF THE SEQUENCES TABLE 1 Sequences SEQ ID NO: Name 1 mRNA COCH c.151C > T 2 mRNA COCH c.263G > A 3 Target c.151C > T + 10 4 Target c.151C > T + 5 5 Target c.151C > T 6 Target c.436 + 368_436 + 369dupAG + 10 7 Target c.436 + 368_436 + 369dupAG + 5 8 Target c.436 + 368_436 + 369dupAG 9 Target c.629 + 1779delC + 10 10 Target c.629 + 1779delC + 5 11 Target c.629 + 1779delC 12 Target c.629 + 1807delA and c.629 + 1809A > C and c.629 + 1812A > T + 10 13 Target c.629 + 1807delA and c.629 + 1809A > C and c.629 + 1812A > T + 5 14 Target c.629 + 1807delA and c.629 + 1809A > C and c.629 + 1812A > T 15 Target c.630 − 208A > C + 10 16 Target c.630 − 208A > C + 5 17 Target c.630 − 208A > C 18 Target c.734 − 304T > G + 10 19 Target c.734 − 304T > G + 5 20 Target c.734 − 304T > G 21 Target c.1477 + 9C > A + 10 22 Target c.1477 + 9C > A + 5 23 Target c.1477 + 9C > A 24 Target c.263G > A + 10 25 Target c.263G > A + 5 26 Target c.263G > A 27 AON X1a 28 AON X1b 29 AON X1c 30 AON X1d 31 AON X1e 32 AON X1f 33 AON X1g 34 AON X1h 35 AON X3a 36 Primer 37 Primer 38 Primer 39 Primer 40 Primer 41 Primer 42 Primer 43 Primer 44 Primer 45 Primer 46 Primer 47 Primer 48 Primer 49 Primer 50 AON_X4a 51 Primer 52 Primer 53 AON_X3b 54 AON_X3c 55 AON_X3d 56 AON_X3e 57 AON_X3f EXAMPLES Materials and Methods Identification of Mutant Allele-Specific Variants in COCH DNA samples of three seemingly unrelated DFNA9 patients carrying the c.151C>T mutation, and one sample from a patient carrying the c.263G>A mutation, were selected for long-read single-molecule (SMRT) sequencing (Pacific Biosciences) to identify shared variants on the mutant allele. The genomic COCH sequence was divided in overlapping fragments ( FIG. 1 A ), which were amplified with Q5 polymerase (NEB) and primers 5′-GAAGTTCGGTTCTCAGGCC-3′ (SEQ ID NO: 36) and 5′-TGCCATCGTCATACAAAAGG-3′ (SEQ ID NO: 37) (fragment 1), 5′-CAAAATCTGGAATGGTATGGAAG-3′ (SEQ ID NO: 38) and 5′-GATCAAATGCAGACCTAGCC-3′ (SEQ ID NO: 39) (fragment 2) and 5′-TCCCCTGCAGTACTTTTTGTC-3′ (SEQ ID NO: 40) and 5′-GTAAGCCAGCTTACAATAACTC-3′ (SEQ ID NO: 41) (fragment 3). Sequence results for the individual fragments were assembled based on the presence of haplotype-specific variants. Identified mutant allele-specific variants with an allele frequency<0.1 in the non-Finnish European population were validated by Sanger sequencing and segregation analysis in two seemingly unrelated families with DFNA9. Generation of a Stable Cell Line with TET-Inducible COCH Expression. The genomic regions of wildtype and mutant COCH exons 1 to 7 (transcript variant 1; Ref.Seq. NM_001135058.1), including the haplotype specific variants, were amplified from the translation initiation site to the splice donor site of exon 7 using primers 5′-ATGTCCGCAGCCTGGATC-3′ (SEQ ID NO: 42) and 5′-GGCTTGAACAAGGCCCACA-3′ (SEQ ID NO: 43). These sequences were subsequently cloned into the pgLAP1 vector using Gateway cloning technology (Invitrogen). Upon sequence validation, pgLAP1-wtCOCH and pgLAP1-P51S-COCH constructs were co-transfected with pOGG44, encoding Flp-Recombinase, in Flp-in™ T-REx™ 293 cells using polyethylenimine. Cells in which the COCH sequence was stably integrated within the genome were selected in DMEM media containing 100 μg/ml hygromycin. Hygromycin-resistant colonies were expanded and subsequently tested for induction of expression by tetracycline using an allele-specific TaqMan assay. Delivery of RNase H1-Dependent Antisense Oligonucleotides Wildtype and mutant COCH-expressing Flp-in™ T-REx™ 293 cells were cultured in high glucose DMEM-AQ (Sigma Aldrich, Saint Louis, USA) supplemented with 10% Fetal Calf Serum, 1% Penicillin/Streptomycin, Sodium Pyruvate, 15 ug/ml blasticidin and 100 ug/ml hygromycin. Cells were seeded in 12-well or 24-well plates at a confluency of ˜ 50%. Next day, culture medium was replaced with medium containing 0.25 μg/ml tetracycline to induce transcript of the introduced COCH gene. After twenty hours, tetracycline-containing medium was refreshed, and cells were transfected with AONs (for AONs used see table 2) using Lipofectamine 2000 (Invitrogen) according to manufacturer's instructions, in a 1:2 ratio of AON (in μg) and lipofectamine reagent (in μl). AON doses are calculated as final concentration in the culture medium. 24 hours after transfection, cells were sampled to quantify COCH transcript levels. To specifically investigate COCH transcript degradation, tetracycline induction of COCH expression was terminated by replacement of the culture medium with Optimem (Sigma Aldrich) prior to transfection. In these experiments, cells were sampled 5 hours after transfection. TABLE 2 AONs tested SEQ ID AON NO Target Sequence X1a 27 C.151C > T CCUGAGCAGAGGACATCUGC X1b 28 C.151C > T CCCTGAGCAGAGGACATCUG X1c 29 C.151C > T CCCCTGAGCAGAGGACAUCU X1d 30 C.151C > T TGAGCAGAGGACATCTGCTT X1e 31 C.151C > T AGCCCCCTGAGCAGAGGACA X1f 32 C.151C > T GCAGCCCCCTGAGCAGAGGA X1g 33 C.151C > T CTGAGCAGAGGACATCTGCT X1h 34 C.151C > T CCCTGAGCAGAGGACATCTG X3a 35 c.436 + 368_436 + ATAGCTAGACCTCTGTCTAA 369dupAG X3b 53 c.436 + 368_436 + UCAUAGCTAGACCTCTGUCU 369dupAG X3c 54 c.436 + 368_436 + AUCATAGCTAGACCTCUGUC 369dupAG X3d 55 c.436 + 368_436 + CAUCATAGCTAGACCTCUGU 369dupAG X3e 56 c.436 + 368_436 + AGCTAGACCTCTGTCTAAAA 369dupAG X3f 57 c.436 + 368_436 + UAGCTAGACCTCTGTCUAAA 369dupAG X4a 50 c.263G > A AUAGACTCGTACAGGUUCCC Delivery of RNase H1-Dependent Antisense Oligonucleotides to Transiently Transfected Cells. Regular HEK-293T cells were cultured in high glucose DMEM-AQ (Sigma Aldrich, Saint Louis, USA) supplemented with 10% Fetal Calf Serum, 1% Penicillin/Streptomycin and 1 mM Sodium Pyruvate. Cells were seeded in 12-well plates in a volume of 1 ml/well, to reach a confluency of ±70% on the day of transfection. Prior to transfection, culture medium was replaced with 1 ml fresh medium. Cells were transfected with a combination of 500 ng of plasmid expressing c.263G>A COCH (SEQ ID NO: 2), and an allele-specific AON X4a (SEQ ID NO: 50) to a final concentration of 250 nM in the culture medium. Transfections were conducted with polyethylenimine (PEI) as described in Roosing et al, 2014. 24 hours post-transfection, cells were sampled for RNA analysis and quantification of COCH transcript levels. RNA Extraction and cDNA Synthesis Total RNA was extracted from cells using Trizol Reagent (Invitrogen) according to manufacturer's instructions. First strand cDNA was generated using the iScript gDNA clear cDNA synthesis kit (Bio-Rad, Hercules, USA) using a fixed amount of RNA input (250 ng) in a 10 ul reaction volume. The obtained cDNA was diluted four times and used for transcript analysis. Quantification of COCH Transcript Levels Four microliters of diluted cDNA was used as input in an allele-specific TaqMan assay using primers 5′-GGACATCAGGAAAGAGAAAGCAGAT-3′ (SEQ ID NO: 44) and 5′-CCCATACACAGAGAATTCCTCAAGAG-3′ (SEQ ID NO: 45), a wildtype allele-specific VIC-labeled probe 5′-CCCCCTGGGCAGAG-3′(SEQ ID NO: 46) and a mutant allele-specific FAM-labeled probe 5′-CCCCCTGAGCAGAG-3′ (SEQ ID NO: 47). Abundance of mutant and wildtype COCH transcripts was calculated relative to the expression of the housekeeping gene RPS18, and normalized to TET-induced samples without AON treatment. Primers used to amplify RPS18 are 5′-ATACAGCCAGGTCCTAGCCA-3′ (SEQ ID NO: 48) and 5′-AAGTGACGCAGCCCTCTATG-3′ (SEQ ID NO: 49). Results Identification of Therapeutic Targets Due to the non-haploinsufficiency mechanism of disease underlying DFNA9, blocking the transcription of or translation from the mutant allele has the potential to halt the progression of the disease. For the development of an antisense oligonucleotide-based therapeutic strategy, reliable discrimination between the mutant and the wildtype allele is of vital importance. Targeting the disease-causing mutation is a commonly used option to discriminate between alleles. However, the disease-causing mutations of DFNA9 are mostly single nucleotide substitutions, leaving little room to design a reliable and robust allele-specific therapy. We sequenced the complete wildtype and mutant alleles of DFNA9 patients with the frequently occurring founder mutations c.151C>T and c.263G>A to identify additional mutant allele-specific variants that can used as targets for the development of antisense therapy. This resulted in the identification of 12 additional intronic variants in cis with the c.151C>T mutation in COCH ( FIG. 1 A ; Table 3), with an allele frequency between 0.04 and 0.1 in the non-Finnish European population according to the GnomAD database (https://gnomad.broadinstitute.org/). TABLE 3 Allele-specific variants in the c.151C > T mutant COCH haplotype with an allele frequency <0.1. AA freq. GnomAD Eur location position identifier c. HGVS change non-Finnish e4 69 (151) [chr14: g.31346846 (GRCh37/hg19)] rs28938175 c.151C > T Pro51Ser n.a. i4 −239 [chr14: g.31347778 (GRCh37/hg19)] rs143609554 c.240 − 239A > T T: 0.05378 i6 +185 [chr14: g.31348876 (GRCh37/hg19)] rs7140538 c.436 + 185G > T T: 0.05481 i6 +370/2 bp [chr14: g.31349060_31349061 rs10701465 c.436 + 368_436 + dupAG: 0.05476 (GRCh37/hg19)] 369dupAG i8 +1186 [chr14: g.31351126 (GRCh37/hg19)] rs186627205 c.629 + 1186T > C C: 0.05432 i8 +1779/1 bp [chr14: g.31351719 (GRCh37/hg19)] rs200080665 c.629 + 1779delC delC: 0.05399 i8 +1807/1 bp [chr14: g.31351747 (GRCh37/hg19)] rs368638521 c.629 + 1807delA n.a. i8 +1809 [chr14: g.31351749 (GRCh37/hg19)] rs554238963 c.629 + 1809A > C C: 0.0994 (dbSNP) i8 +1812 [chr14: g.31351752 (GRCh37/hg19)] rs184635675 c.629 + 1812A > T T: 0.05427 i8 −208 [chr14: g.31353551 (GRCh37/hg19)] rs2295128 c.630 − 208A > C C: 0.05253 i9 −304 [chr14: g.31354296 (GRCh37/hg19)] rs28362773 c.734 − 304T > G G: 0.07141 i11 +9 [chr14: g.31355527 (GRCh37/hg19)] rs17097458 c.1477 + 9C > A A: 0.05364 i11 −1474/1 bp [chr14: g.31357348 (GRCh37/hg19)] rs398024681 c.1478 − 1474delT n.a. Antisense Oligonucleotides Complementary to Sequences Containing Allele-Discriminating Variants Significantly Reduce Mutant COCH Transcript Levels. As frequently-used patient-derived cell models, such as fibroblasts, hardly express the COCH gene, we generated stable transgenic cell models in which mutant or wildtype COCH alleles can be expressed using a tetracycline-inducible promoter. To identify AONs with the ability to degrade mutant COCH transcripts, cells were seeded in multi-well plates, and subsequently treated with tetracycline to induce COCH expression. Next, cells were treated with different AONs complementary to the c.151C>T mutation and flanking sequence (target X1, FIG. 2 A , left panel). In this initial screen to identify the optimal AON sequences, a single well was transfected per AON sequence, with the exception of AON_X1b. Except for AON_X1a, all AONs directed against target X1 resulted in a reduction of mutant COCH transcript levels. In a separate experiment, the potential of AON X3a (complementary to the c.436+368_436+369 dupAG variant and surrounding sequence on the c.151C>T COCH allele; target X3) to degrade mutant COCH transcripts was analyzed (in triplo) using a dose of 250 nM ( FIG. 2 A , right panel). Transfection of cells with AON X3a indeed also resulted in a reduction of c.151C>T COCH transcript levels. Upon the observed reduction of c.151C>T COCH transcript levels after treatment with AON X3a, we investigated a mixture of gapmer and non-gapmer AON sequences directed against the c.436+368_436+369 dupAG variant for their ability reduce c.151C>T COCH transcript levels ( FIG. 2 B ). In particular, treatment of cells with AONs X3a, X3b, X3e and X3g resulted in a decrease in c.151C>T COCH transcript levels. The ability of AON X1b, X1e and X3a to induce the degradation of c.151C>T-containing COCH transcripts was subsequently investigated using an AON concentration of 25, 100 and 250 nM ( FIG. 3 ). Quantitative analyses revealed that AON X1b and X1e were able to degrade c.151C>T COCH transcripts in a dose-dependent manner. For AON X3a, a mild decrease of c.151C>T COCH transcript levels was observed at a concentration of 100 nM (p=0.07). In FIG. 3 A , AON X1b (left panel), but not AONs X1e (middle panel) and X3a (right panel) had a gapmer composition. Therefore, we next investigated the effect of AON sequences X1e and X3a in gapmer composition ( FIG. 3 B ) at concentrations of 100 and 250 nM. We furthermore included a third AON directed against the c.151C>T target (AON X1f). Quantitative analyses revealed that gapmer AON X1e was able to degrade c.151C>T COCH transcripts in a dose-dependent manner ( FIG. 3 B , left panel). In addition, gapmer AONs X1f and X3e also resulted in a significant decrease of c.151C>T mutant COCH transcripts compared to cells treated with a control AON. In contrast with AON X1e, the maximum reduction in mutant COCH transcript level appears to be already achieved at the lowest dose tested ( FIG. 3 B , middle and right panel). To show that the AON molecules indeed increased degradation of COCH transcripts, and not interfered with the induction of COCH expression, a second experimental paradigm was used. Cells were seeded and subsequently treated with tetracycline to induce COCH expression. After 20 hours, tetracycline was washed away to stop the induction of COCH expression. From this moment onwards, COCH transcripts undergo natural breakdown at a speed that can be increased by the delivery of AONs complementary to the target sequence. In this paradigm, we furthermore investigated the allele-specificity of the different AONs. Upon transfection in the mutant (c.151C>T) COCH-expressing T-REx 293 cells, AON_X1b (directed at the region containing the c.151C>T mutation) and AON_X3a (directed at the region containing the c.436+368_436+369 dupAG variant), both resulted in a significant reduction of mutant COCH transcript levels as compared to untreated cells. Using this experimental setup, no difference in effect size between AONs directed at the different targets was observed. Furthermore, both AONs show a high binding specificity for the c.151C>T-mutant COCH allele, as no decrease in wildtype COCH transcript levels is observed when wildtype COCH-expressing T-REx 293 cells were transfected with these AONs ( FIG. 4 B ). Thus, these data nicely show that the AONs induce increase breakdown of c.151C>T COCH transcripts. We additionally, investigated the effects of selected AONs under continuous COCH transcription ( FIG. 5 ). This situation better resembles the continuous expression of COCH in the human cochlea. Transfection of c.151C>T mutant COCH expressing cells with 100 nM AONs X1e, X1f and X3a resulted in a significant decrease of c.151C>T COCH transcripts as compared to control transfected cells ( FIG. 5 A ). Transfection of the same cells with AON X1b, effective under halted COCH transcription ( FIG. 4 ), resulted in a non-significant decrease of mutant COCH transcripts. Likely higher concentrations of AON X1b, are required to induce as significant decrease in mutant COCH transcript levels under continuous COCH transcription. Transfection of the same AONs in cells expressing wildtype COCH transcripts, had no significant effect on the levels of wildtype COCH transcripts as compared to control transfected cells, indicating specificity for the mutant allele for these AONs ( FIG. 5 B ). The fact that AON_X3a targets an intronic variant that is specific to the c.151C>T mutant COCH allele, and AON_X1f targets the mutation itself, have result in a similar decrease in mutant COCH transcripts, indicates that targeting mutant allele-specific variants is also a powerful method to decrease mutant COCH transcript levels. Finally, we investigated the effect of AONs specific to the c.263G>A mutant COCH allele. The c.263G>A mutation, was discovered as a founder mutation in the America population, and also leads to DFNA9. We co-transfected plasmids encoding c.263G>A mutant COCH with AON_X4a in regular HEK-293T cells. AON_X4a was able to induce a significant decrease in c.263G>A mutant COCH transcripts ( FIG. 6 ). CONCLUSION Overall, our results demonstrate that the delivery of antisense oligonucleotides can be used to specifically decrease the levels of mutant COCH transcripts. DFNA9 is a dominantly inherited disease, where the protein encoded by the mutant COCH gene interferes with normal function of the cochlea and the vestibular organ. DFNA9 patients all have a single healthy copy of the COCH gene that, in absence of mutant cochlin proteins, is sufficient for normal function of the inner ear (Robertson et al., 2008; JanssensdeVarebeke et al., 2018). Therefore, AONs according to the invention can be used in the treatment of human subjects suffering from hearing impairment and/or vestibular dysfunction due to mutations in the COCH gene. REFERENCES Bom S J H, Kemperman M H, Huygen P L M, Luijendijk M W J, Cremers C W R J. Cross-sectional analysis of hearing threshold in relation to age in a large family with cochleovestibular impairment thoroughly genotyped for DFNA9/COCH. Ann. Otol. Rhinol. Laryngol. 2003 March; 112(3):280-6. Crosby J R, Zhao C, Jiang C, Bai D, Katz M, Greenlee S, et al. Inhaled ENaC antisense oligonucleotide ameliorates cystic fibrosis-like lung disease in mice. J. Cyst. Fibros. 2017 November; 16(6):671-80. de Kok Y J, Born S J, Brunt T M, Kemperman M H, van Beusekom E, van der Velde-Visser S D, et al. A Pro51Ser mutation in the COCH gene is associated with late onset autosomal dominant progressive sensorineural hearing loss with vestibular defects. Hum Mol Genet. 1999 February; 8(2):361-6. Gallant E, Francey L, Fetting H, Kaur M, Hakonarson H, Clark D, et al. Novel COCH mutation in a family with autosomal dominant late onset sensorineural hearing impairment and tinnitus. Am J Otolaryngol. 2013 May; 34(3):230-5. Ikezono T, Omori A, Ichinose S, Pawankar R, Watanabe A, Yagi T. Identification of the protein product of the Coch gene (hereditary deafness gene) as the major component of bovine inner ear protein. Biochim Biophys Acta. 2001 Mar. 26; 1535(3):258-65. JanssensdeVarebeke SPF, Van Camp G, Peeters N, Elinck E, Widdershoven J, Cox T, et al. Bi-allelic inactivating variants in the COCH gene cause autosomal recessive prelingual hearing impairment. Eur. J. Hum. Genet. Nature Publishing Group; 2018 Feb. 15; 23:42. PMCID: PMC5891501 Jones S M, Robertson N G, Given S, Giersch A B S, Liberman M C, Morton C C. Hearing and vestibular deficits in the Coch(−/−) null mouse model: comparison to the Coch(G88E/G88E) mouse and to DFNA9 hearing and balance disorder. Hear. Res. 2011 February; 272(1-2):42-8. PMCID: PMC3039082 Jung J, Yoo J E, Choe Y H, Park S C, Lee H J, Lee H J, et al. Cleaved Cochlin Sequesters Pseudomonas aeruginosa and Activates Innate Immunity in the Inner Ear. Cell Host & Microbe. Cell Press; 2019 Apr. 10; 25(4):513-6. Kommareddi P K, Nair T S, Raphael Y, Telian S A, Kim A H, Arts H A, et al. Cochlin isoforms and their interaction with CTL2 (SLC44A2) in the inner ear. J. Assoc. Res. Otolaryngol. 2007 December; 8(4):435-46. PMCID: PMC2538338 Kordasiewicz H B, Stanek L M, Wancewicz E V, Mazur C, McAlonis M M, Pytel K A, et al. Sustained therapeutic reversal of Huntington's disease by transient repression of huntingtin synthesis. Neuron. 2012 Jun. 21; 74(6):1031-44. PMCID: PMC3383626 Liang X-H, Sun H, Nichols J G, Crooke S T. RNase H1-Dependent Antisense Oligonucleotides Are Robustly Active in Directing RNA Cleavage in Both the Cytoplasm and the Nucleus. 2017 Sep. 6; 25(9):2075-92. Retrieved from: http://linkinghub.elsevier.com/retrieve/pii/S1525001617302629 Nagy I, Trexler M, Patthy L. The second von Willebrand type A domain of cochlin has high affinity for type I, type II and type IV collagens. Febs Lett. John Wiley & Sons, Ltd; 2008 Dec. 10; 582(29):4003-7. Robertson N G, Cremers C W R J, Huygen P L M, Ikezono T, Krastins B, Kremer H, et al. Cochlin immunostaining of inner ear pathologic deposits and proteomic analysis in DFNA9 deafness and vestibular dysfunction. Hum Mol Genet. 2006 Apr. 1; 15(7):1071-85. Robertson N G, Jones S M, Sivakumaran T A, Giersch A B S, Jurado S A, Call L M, et al. A targeted Coch missense mutation: a knock-in mouse model for DFNA9 late-onset hearing loss and vestibular dysfunction. Hum Mol Genet. Oxford University Press; 2008 Nov. 1; 17(21):3426-34. PMCID: PMC2566528 Robertson N G, Lu L, Heller S, Merchant S N, Eavey R D, McKenna M, et al. Mutations in a novel cochlear gene cause DFNA9, a human nonsyndromic deafness with vestibular dysfunction. Nat. Genet. 1998 November; 20(3):299-303. Vickers T A, Crooke S T. Antisense Oligonucleotides Capable of Promoting Specific Target mRNA Reduction via Competing RNase H1-Dependent and Independent Mechanisms. Buratti E, editor. PLoS One. 2014 Oct. 9; 9(10):e108625. Wang L, Kempton J B, Brigande J V. Gene Therapy in Mouse Models of Deafness and Balance Dysfunction. Front Mol Neurosci. 2018; 11:300. PMCID: PMC6123355 Yao J, Py B F, Zhu H, Bao J, Yuan J. Role of protein misfolding in DFNA9 hearing loss. Journal of Biological Chemistry. American Society for Biochemistry and Molecular Biology; 2010 May 14; 285(20):14909-19. PMCID: PMC2865277 Roosing, S., Lamers, I. J. C., de Vrieze, E., van den Born, L. I., Lambertus, S., Arts, H. H., et al. Disruption of the basal body protein POC1B results in autosomal-recessive cone-rod dystrophy. American Journal of Human Genetics; 2014, 95(2), 131-142. PMCID: PMC4129401
Citations
This patent cites (3)
- USWO00/18211
- USWO00/71081
- USWO2019/028246