Conjugated Oligonucleotide Compounds, Methods of Making and Uses Thereof

Abstract
The present invention relates to novel conjugated oligonucleotide compounds, which are suitable for therapeutic use. Additionally, the present invention provides methods of making these compounds, as well as methods of using such compounds for the treatment of various diseases and conditions.
Claims (19)
1. A compound of Formula (I):
10. A compound having the structure of: (i) Formula (II):
11. A compound having the structure of: (i) Formula (VIII):
Show 16 dependent claims
2. The compound according to claim 1 , wherein R 1 is hydrogen at each occurrence.
3. The compound according to claim 1 , wherein m=3.
4. The compound according to claim 1 , wherein n=6.
5. The compound according to claim 1 , wherein X 1 is oxygen and X 2 is methylene.
6. The compound according to claim 1 , wherein both X 1 and X 2 are methylene.
7. The compound according to claim 1 , wherein the oligonucleotide is an RNA capable of modulating, or inhibiting, expression of a target gene.
8. The compound according to claim 1 , wherein the RNA is attached at the 5′ end of its second strand to the adjacent phosphate.
9. The compound according to claim 1 , wherein the RNA is attached at the 3′ end of its second strand to the adjacent phosphate.
12. The compound according to claim 10 , wherein the oligonucleotide comprises one or more degradation protective moieties at one or more ends.
13. A pharmaceutical composition comprising of a compound according to claim 1 , together with a pharmaceutically acceptable carrier, diluent or excipient.
14. The compound according to claim 5 , wherein: q=1, r=2, s=1, t=1, and v=1.
15. The compound according to claim 6 , wherein: q=1, r=3, s=1, t=1, and v=1.
16. The compound according to claim 7 , wherein the RNA is an RNA duplex comprising first and second strands, wherein the first strand is at least partially complementary to an RNA sequence of a target gene, and the second strand is at least partially complementary to said first strand, and wherein each of the first and second strands have 5′ and 3′ ends.
17. The compound according to claim 12 , wherein the one or more degradation protective moieties is selected from the group consisting of phosphorothioate internucleotide linkages, phosphorodithioate internucleotide linkages and inverted abasic nucleotides, wherein the inverted abasic nucleotides are present at the distal end of the strand that carries the ligand moieties.
18. The compound according to claim 1 , wherein R 2 is hydroxy.
19. The compound according to claim 1 , wherein R 2 is fluoro.
Full Description
Show full text →
CROSS REFERENCE TO RELATED APPLICATIONS
This application is Continuation of International Application No. PCT/EP2022/052067, filed internationally on Jan. 28, 2022, which claims priority to U.S. Provisional Application No. 63/143,805, filed Jan. 30, 2021, U.S. Provisional Application No. 63/262,311, filed on Oct. 8, 2021, and U.S. Provisional Application No. 63/271,686, filed on Oct. 25, 2021, the contents of each of which are incorporated herein by reference in their entireties.
REFERENCE TO AN ELECTRONIC SEQUENCE LISTING
The contents of the electronic sequence listing (228792000101substituteseglist.xml; Size: 230,685 bytes; and Date of Creation: Feb. 26, 2024) is herein incorporated by reference in its entirety.
FIELD
The present invention provides novel conjugated oligonucleotide compounds, which are suitable for therapeutic use. Additionally, the present invention provides methods of making these compounds, as well as methods of using such compounds for the treatment of various diseases and conditions.
BACKGROUND
Oligonucleotide compounds have important therapeutic applications in medicine. Oligonucleotides can be used to silence genes that are responsible for a particular disease. Gene-silencing prevents formation of a protein by inhibiting translation. Importantly, gene-silencing agents are a promising alternative to traditional small, organic compounds that inhibit the function of the protein linked to the disease. siRNA, antisense RNA, and micro-RNA are oligonucleotides that prevent the formation of proteins by gene-silencing.
A number of modified siRNA compounds in particular have been developed in the last two decades for diagnostic and therapeutic purposes, including SiRNA/RNAi therapeutic agents for the treatment of various diseases including central-nervous-system diseases, inflammatory diseases, metabolic disorders, oncology, infectious diseases, and ocular diseases.
Efficient delivery of oligonucleotides to cells in vivo requires specific targeting and substantial protection from the extracellular environment, particularly serum proteins. One method of achieving specific targeting is to conjugate a ligand targeting moiety to the oligonucleotide agent. The ligand targeting moiety helps delivering the oligonucleotide to the required target site. For example, attaching a ligand targeting moiety comprising a terminal galactose or derivative thereof to an oligonucleotide aids targeting to hepatocytes via binding to the asialoglycoprotein receptor (ASGPR).
There exists a need for novel, ligand-conjugated oligonucleotides, and methods for their preparation.
SUMMARY
The present invention provides novel, ligand-conjugated oligonucleotide compounds, methods of making these compounds and uses thereof.
Provided herein is a compound comprising the following structure:
•
• wherein: • R 1 at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl; • R 2 is selected from the group consisting of hydrogen, hydroxy, —OC 1-3 alkyl, —C(═O)OC 1-3 alkyl, halo and nitro; • X 1 and X 2 at each occurrence are independently selected from the group consisting of methylene, oxygen and sulfur; • m is an integer of from 1 to 6; • n is an integer of from 1 to 10; • q, r, s, t, v are independently integers from 0 to 4, with the proviso that: • (i) q and r cannot both be 0 at the same time; and • (ii) s, t and v cannot all be 0 at the same time; • Z is an oligonucleotide moiety.
Provided herein is a compound of Formula (II):
Provided herein is a compound of Formula (III):
Provided herein is a composition comprising a compound of Formula (II) as described anywhere herein, and a compound of Formula (III) as described anywhere herein.
Provided herein is a compound of Formula (IV):
Provided herein is a compound of Formula (V):
Provided herein is a composition comprising a compound of Formula (IV) as described anywhere herein, and a compound of Formula (V) as described anywhere herein.
Provided herein is a compound of Formula (VIII):
Provided herein is a compound of Formula (IX):
Provided herein is a compound of Formula (X):
Provided herein is a compound of Formula (XI):
Provided herein is a composition comprising a compound of Formula (VIII) as described anywhere herein, and a compound of Formula (IX) as described anywhere herein. Provided herein is a composition comprising a compound of Formula (X) as described anywhere herein, and a compound of Formula (XI) as described anywhere herein.
Provided herein is a process of preparing a compound as described anywhere herein, and/or a composition as described anywhere herein, which comprises reacting compounds of Formulae (XII) and (XIII):
•
• wherein: • R 1 at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl; • R 2 is selected from the group consisting of hydrogen, hydroxy, —OC 1-3 alkyl, —C(═O)OC 1-3 alkyl, halo and nitro; • X 1 and X 2 at each occurrence are independently selected from the group consisting of methylene, oxygen and sulfur; • m is an integer of from 1 to 6; • n is an integer of from 1 to 10; • q, r, s, t, v are independently integers from 0 to 4, with the proviso that: • (i) q and r cannot both be 0 at the same time; and • (ii) s, t and v cannot all be 0 at the same time; is an oligonucleotide moiety; • and where appropriate carrying out deprotection of the ligand and/or annealing of a second strand for the oligonucleotide moiety.
Provided herein is a compound of Formula (XII):
•
• wherein: • R 1 at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl; • R 2 is selected from the group consisting of hydrogen, hydroxy, —OC 1-3 alkyl, —C(═O)OC 1-3 alkyl, halo and nitro; • X 1 and X 2 at each occurrence are independently selected from the group consisting of methylene, oxygen and sulfur; • q, r, s, t, v are independently integers from 0 to 4, with the proviso that: • (i) q and r cannot both be 0 at the same time; and • (ii) s, t and v cannot all be 0 at the same time; • Z is an oligonucleotide moiety.
Provided herein is a compound of Formula (XIIa):
Provided herein is a compound of Formula (XIIb):
Provided herein is a compound of Formula (XIIc):
Provided herein is a compound of Formula (XIId):
Provided herein is a compound of Formula (XIII):
•
• wherein: • R 1 at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl; • m is an integer of from 1 to 6; • n is an integer of from 1 to 10.
Provided herein is a compound of Formula (XIIIa):
Provided herein is a compound of Formula (XIIIb):
Provided herein is a compound of Formula (XIV):
•
• wherein: • R 1 is selected from the group consisting of hydrogen, methyl and ethyl; • R 2 is selected from the group consisting of hydrogen, hydroxy, —OC 1-3 alkyl, —C(═O)OC 1-3 alkyl, halo and nitro; • X 2 is selected from the group consisting of methylene, oxygen and sulfur; • s, t, v are independently integers from 0 to 4, with the proviso that s, t and v cannot all be 0 at the same time.
Provided herein is a compound of Formula (XIVa):
Provided herein is a compound of Formula (XIVb):
Provided herein is a compound of Formula (XV):
•
• wherein: • R 1 at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl; • X 1 is selected from the group consisting of methylene, oxygen and sulfur; • q and r are independently integers from 0 to 4, with the proviso that q and r cannot both be 0 at the same time; • Z is an oligonucleotide moiety.
Provided herein is a compound of Formula (XVa):
Provided herein is a compound of Formula (XVb):
Provided herein is use of a compound as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein.
Provided herein is use of a compound of Formula (XII) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein.
Provided herein is use of a compound of Formula (XIII) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein.
Provided herein is use of a compound of Formula (XIV) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein.
Provided herein is use of a compound of Formula (XV) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein.
Provided herein is use of a compound of Formula (XIIa) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein.
Provided herein is use of a compound of Formula (XIIb) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein.
Provided herein is use of a compound of Formula (XIIc) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein.
Provided herein is use of a compound of Formula (XIId) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein.
Provided herein is use of a compound of Formula (XIIIa) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein.
Provided herein is use of a compound of Formula (XIIIb) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein.
Provided herein is use of a compound of Formula (XIVa) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein.
Provided herein is use of a compound of Formula (XIVb) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein.
Provided herein is use of a compound of Formula (XVa) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein.
Provided herein is use of a compound of Formula (XVb) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein.
Provided herein is a compound or composition obtained, or obtainable by a process as described anywhere herein.
Provided herein is a pharmaceutical composition comprising of a compound as described anywhere herein, and/or a composition as described anywhere herein, together with a pharmaceutically acceptable carrier, diluent or excipient.
Provided herein is a compound as described anywhere herein, and/or a composition as described anywhere herein, for use in therapy.
BRIEF DESCRIPTION OF THE FIGURES
shows analysis of hsC5 mRNA expression levels in a total of 45 human-derived cancer cell lysates and lysates of primary human hepatocytes (PHHs). mRNA expression levels are shown in relative light units [RLUs].
shows analysis of hsHAO1 mRNA expression levels in a total of 45 human-derived cancer cell lysates and lysates of primary human hepatocytes (PHHs). mRNA expression levels are shown in relative light units [RLUs].
shows analysis of hsTTR mRNA expression levels in a total of 45 human-derived cancer cell lysates and lysates of primary human hepatocytes (PHHs). mRNA expression levels are shown in relative light units [RLUs].
A- 4 D shows the results from the dose-response analysis of hsTTR targeting GalNAc-siRNAs in HepG2 cells in Example 1.
A- 5 D shows the results from the dose-response analysis of hsC5 targeting GalNAc-siRNAs in HepG2 cells in Example 1.
shows the analysis of hsTTR (top), hsC5 (middle) and hsHAO1 (bottom) mRNA expression levels in all three batches of primary human hepatocytes BHuf16087 (left), CHF2101 (middle) and CyHufl9009 (right) each after 0 h, 24 h, 48 h and 72 h in culture. mRNA expression levels are shown in relative light units [RLUs].
shows the analysis of hsGAPDH (top) and hsAHSA1 (bottom) mRNA expression levels in all three batches of primary human hepatocytes BHuf16087 (left), CHF2101 (middle) and CyHufl9009 (right) each after 0 h, 24 h, 48 h and 72 h in culture. mRNA expression levels are shown in relative light units [RLUs].
A- 8 D shows the results from the dose-response analysis of hsHAO1 targeting GalNAc-siRNAs in PHHs in Example 1.
A- 9 D shows the results from the dose-response analysis of hsC5 targeting GalNAc-siRNAs in PHHs in Example 1.
A- 10 D shows the results from the dose-response analysis of hsTTR targeting GalNAc-siRNAs in PHHs in Example 1.
. Single dose mouse pharmacology of ETX005. HAO1 mRNA expression is shown relative to the saline control group. Each point represents the mean and standard deviation of 3 mice.
. Single dose mouse pharmacology of ETX005. Serum glycolate concentration is shown. Each point represents the mean and standard deviation of 3 mice, except for baseline glycolate concentration (day 0) which was derived from a group of 5 mice.
. Single dose mouse pharmacology of ETX014. C5 mRNA expression is shown relative to the saline control group. Each point represents the mean and standard deviation of 3 mice.
. Single dose mouse pharmacology of ETX0014. Serum C5 concentration is shown relative to the saline control group. Each point represents the mean and standard deviation of 3 mice.
. Single dose NHP pharmacology of ETX023. Serum TTR concentration is shown relative to day 1 of the study. Each point represents the mean and standard deviation of 3 animals.
. Single dose NHP pharmacology of ETX019. Serum TTR concentration is shown relative to day 1 of the study and also pre-dose. Each point represents the mean and standard deviation of 3 animals. Time points up to 84 days are shown.
. Single dose NHP pharmacology of ETX021. Serum TTR concentration is shown relative to day 1 of the study and also pre-dose. Each point represents the mean and standard deviation of 3 animals. Time points up to 84 days are shown.
A . Single dose NHP pharmacology of ETX023. Serum TTR concentration is shown relative to day 1 of the study and also pre-dose. Each point represents the mean and standard deviation of 3 animals. Time points up to 84 days are shown.
B . Sustained suppression of TTR gene expression in the liver after a single 1 mg/kg dose of ETX023. TTR mRNA is shown relative to baseline levels measured pre-dose. Each point represents the mean and standard deviation of 3 animals. Time points up to 84 days are shown.
C . Body weight of animals dosed with a single 1 mg/kg dose of ETX023. Each point represents the mean and standard deviation of 3 animals. Time points up to 84 days are shown.
D . ALT concentration in serum from animals treated with a single 1 mg/kg dose of ETX023. Each point represents the mean and standard deviation of 3 animals. The shaded are shows the range of values considered normal at the facility used for the study. The dotted lines show values considered normal for this species (Park et al. 2016 Reference values of clinical pathology parameter in cynomolgus monkeys used in preclinical studies. Lab Anim Res 32:79-86.) Time points up to 84 days are shown.
E . AST concentration in serum from animals treated with a single 1 mg/kg dose of ETX023. Each point represents the mean and standard deviation of 3 animals. The shaded are shows the range of values considered normal at the facility used for the study. The dotted lines show values considered normal for this species (Park et al. 2016 Reference values of clinical pathology parameter in cynomolgus monkeys used in preclinical studies. Lab Anim Res 32:79-86. Time points up to 84 days are shown.
. Single dose NHP pharmacology of ETX025. Serum TTR concentration is shown relative to day 1 of the study and also pre-dose. Each point represents the mean and standard deviation of 3 animals. Time points up to 84 days are shown.
. Linker and ligand moiety for ETX005, 007, 0014, 0016, 0023 and 0025.
It should also be understood that where appropriate while ETX005 as a product includes molecules based on the linker and ligand portions as specifically depicted in attached to an oligonucleotide moiety as also depicted herein, this ETX005 product may alternatively further comprise, or consist essentially of, molecules wherein the linker and ligand portions are essentially as depicted in attached to an oligonucleotide moiety but having the F substituent as shown in on the cyclo-octyl ring replaced by a substituent occurring as a result of hydrolytic displacement, such as an OH substituent. In this way, (a) ETX005 can consist essentially of molecules having linker and ligand portions specifically as depicted in , with a F substituent on the cyclo-octyl ring; or (b) ETX005 can consist essentially of molecules having linker and ligand portions essentially as depicted in but having the F substituent as shown in on the cyclo-octyl ring replaced by a substituent occurring as a result of hydrolytic displacement, such as an OH substituent, or (c) ETX005 can comprise a mixture of molecules as defined in (a) and/or (b).
It should also be understood that where appropriate while ETX007 as a product includes molecules based on the linker and ligand portions as specifically depicted in attached to an oligonucleotide moiety as also depicted herein, this ETX007 product may alternatively further comprise, or consist essentially of, molecules wherein the linker and ligand portions are essentially as depicted in attached to an oligonucleotide moiety but having the F substituent as shown in on the cyclo-octyl ring replaced by a substituent occurring as a result of hydrolytic displacement, such as an OH substituent. In this way, (a) ETX007 can consist essentially of molecules having linker and ligand portions specifically as depicted in , with a F substituent on the cyclo-octyl ring; or (b) ETX007 can consist essentially of molecules having linker and ligand portions essentially as depicted in but having the F substituent as shown in on the cyclo-octyl ring replaced by a substituent occurring as a result of hydrolytic displacement, such as an OH substituent, or (c) ETX007 can comprise a mixture of molecules as defined in (a) and/or (b).
It should also be understood that where appropriate while ETX014 as a product includes molecules based on the linker and ligand portions as specifically depicted in attached to an oligonucleotide moiety as also depicted herein, this ETX014 product may alternatively further comprise, or consist essentially of, molecules wherein the linker and ligand portions are essentially as depicted in attached to an oligonucleotide moiety but having the F substituent as shown in on the cyclo-octyl ring replaced by a substituent occurring as a result of hydrolytic displacement, such as an OH substituent. In this way, (a) ETX014 can consist essentially of molecules having linker and ligand portions specifically as depicted in , with a F substituent on the cyclo-octyl ring; or (b) ETX014 can consist essentially of molecules having linker and ligand portions essentially as depicted in but having the F substituent as shown in on the cyclo-octyl ring replaced by a substituent occurring as a result of hydrolytic displacement, such as an OH substituent, or (c) ETX014 can comprise a mixture of molecules as defined in (a) and/or (b).
It should also be understood that where appropriate while ETX016 as a product includes molecules based on the linker and ligand portions as specifically depicted in attached to an oligonucleotide moiety as also depicted herein, this ETX016 product may alternatively further comprise, or consist essentially of, molecules wherein the linker and ligand portions are essentially as depicted in attached to an oligonucleotide moiety but having the F substituent as shown in on the cyclo-octyl ring replaced by a substituent occurring as a result of hydrolytic displacement, such as an OH substituent. In this way, (a) ETX016 can consist essentially of molecules having linker and ligand portions specifically as depicted in , with a F substituent on the cyclo-octyl ring; or (b) ETX016 can consist essentially of molecules having linker and ligand portions essentially as depicted in but having the F substituent as shown in on the cyclo-octyl ring replaced by a substituent occurring as a result of hydrolytic displacement, such as an OH substituent, or (c) ETX016 can comprise a mixture of molecules as defined in (a) and/or (b).
It should also be understood that where appropriate while ETX023 as a product includes molecules based on the linker and ligand portions as specifically depicted in attached to an oligonucleotide moiety as also depicted herein, this ETX023 product may alternatively further comprise, or consist essentially of, molecules wherein the linker and ligand portions are essentially as depicted in attached to an oligonucleotide moiety but having the F substituent as shown in on the cyclo-octyl ring replaced by a substituent occurring as a result of hydrolytic displacement, such as an OH substituent. In this way, (a) ETX023 can consist essentially of molecules having linker and ligand portions specifically as depicted in , with a F substituent on the cyclo-octyl ring; or (b) ETX023 can consist essentially of molecules having linker and ligand portions essentially as depicted in but having the F substituent as shown in on the cyclo-octyl ring replaced by a substituent occurring as a result of hydrolytic displacement, such as an OH substituent, or (c) ETX023 can comprise a mixture of molecules as defined in (a) and/or (b).
It should also be understood that where appropriate while ETX025 as a product includes molecules based on the linker and ligand portions as specifically depicted in attached to an oligonucleotide moiety as also depicted herein, this ETX025 product may alternatively further comprise, or consist essentially of, molecules wherein the linker and ligand portions are essentially as depicted in attached to an oligonucleotide moiety but having the F substituent as shown in on the cyclo-octyl ring replaced by a substituent occurring as a result of hydrolytic displacement, such as an OH substituent. In this way, (a) ETX025 can consist essentially of molecules having linker and ligand portions specifically as depicted in , with a F substituent on the cyclo-octyl ring; or (b) ETX025 can consist essentially of molecules having linker and ligand portions essentially as depicted in A- 30 B but having the F substituent as shown in on the cyclo-octyl ring replaced by a substituent occurring as a result of hydrolytic displacement, such as an OH substituent, or (c) ETX025 can comprise a mixture of molecules as defined in (a) and/or (b).
. Linker and ligand moiety for ETX003, 001, 0010, 0012, 0019 and 0021.
It should also be understood that where appropriate while ETX001 as a product includes molecules based on the linker and ligand portions as specifically depicted in attached to an oligonucleotide moiety as also depicted herein, this ETX001 product may alternatively further comprise, or consist essentially of, molecules wherein the linker and ligand portions are essentially as depicted in attached to an oligonucleotide moiety but having the F substituent as shown in on the cyclo-octyl ring replaced by a substituent occurring as a result of hydrolytic displacement, such as an OH substituent. In this way, (a) ETX001 can consist essentially of molecules having linker and ligand portions specifically as depicted in , with a F substituent on the cyclo-octyl ring; or (b) ETX001 can consist essentially of molecules having linker and ligand portions essentially as depicted in but having the F substituent as shown in on the cyclo-octyl ring replaced by a substituent occurring as a result of hydrolytic displacement, such as an OH substituent, or (c) ETX001 can comprise a mixture of molecules as defined in (a) and/or (b).
It should also be understood that where appropriate while ETX003 as a product includes molecules based on the linker and ligand portions as specifically depicted in attached to an oligonucleotide moiety as also depicted herein, this ETX003 product may alternatively further comprise, or consist essentially of, molecules wherein the linker and ligand portions are essentially as depicted in attached to an oligonucleotide moiety but having the F substituent as shown in on the cyclo-octyl ring replaced by a substituent occurring as a result of hydrolytic displacement, such as an OH substituent. In this way, (a) ETX003 can consist essentially of molecules having linker and ligand portions specifically as depicted in , with a F substituent on the cyclo-octyl ring; or (b) ETX003 can consist essentially of molecules having linker and ligand portions essentially as depicted in but having the F substituent as shown in on the cyclo-octyl ring replaced by a substituent occurring as a result of hydrolytic displacement, such as an OH substituent, or (c) ETX003 can comprise a mixture of molecules as defined in (a) and/or (b).
It should also be understood that where appropriate while ETX010 as a product includes molecules based on the linker and ligand portions as specifically depicted in attached to an oligonucleotide moiety as also depicted herein, this ETX010 product may alternatively further comprise, or consist essentially of, molecules wherein the linker and ligand portions are essentially as depicted in attached to an oligonucleotide moiety but having the F substituent as shown in on the cyclo-octyl ring replaced by a substituent occurring as a result of hydrolytic displacement, such as an OH substituent. In this way, (a) ETX010 can consist essentially of molecules having linker and ligand portions specifically as depicted in , with a F substituent on the cyclo-octyl ring; or (b) ETX010 can consist essentially of molecules having linker and ligand portions essentially as depicted in but having the F substituent as shown in on the cyclo-octyl ring replaced by a substituent occurring as a result of hydrolytic displacement, such as an OH substituent, or (c) ETX010 can comprise a mixture of molecules as defined in (a) and/or (b).
It should also be understood that where appropriate while ETX012 as a product includes molecules based on the linker and ligand portions as specifically depicted in attached to an oligonucleotide moiety as also depicted herein, this ETX012 product may alternatively further comprise, or consist essentially of, molecules wherein the linker and ligand portions are essentially as depicted in attached to an oligonucleotide moiety but having the F substituent as shown in on the cyclo-octyl ring replaced by a substituent occurring as a result of hydrolytic displacement, such as an OH substituent. In this way, (a) ETX012 can consist essentially of molecules having linker and ligand portions specifically as depicted in , with a F substituent on the cyclo-octyl ring; or (b) ETX012 can consist essentially of molecules having linker and ligand portions essentially as depicted in but having the F substituent as shown in on the cyclo-octyl ring replaced by a substituent occurring as a result of hydrolytic displacement, such as an OH substituent, or (c) ETX012 can comprise a mixture of molecules as defined in (a) and/or (b).
It should also be understood that where appropriate while ETX019 as a product includes molecules based on the linker and ligand portions as specifically depicted in attached to an oligonucleotide moiety as also depicted herein, this ETX019 product may alternatively further comprise, or consist essentially of, molecules wherein the linker and ligand portions are essentially as depicted in attached to an oligonucleotide moiety but having the F substituent as shown in on the cyclo-octyl ring replaced by a substituent occurring as a result of hydrolytic displacement, such as an OH substituent. In this way, (a) ETX019 can consist essentially of molecules having linker and ligand portions specifically as depicted in , with a F substituent on the cyclo-octyl ring; or (b) ETX019 can consist essentially of molecules having linker and ligand portions essentially as depicted in A- 30 B but having the F substituent as shown in on the cyclo-octyl ring replaced by a substituent occurring as a result of hydrolytic displacement, such as an OH substituent, or (c) ETX019 can comprise a mixture of molecules as defined in (a) and/or (b).
It should also be understood that where appropriate while ETX021 as a product includes molecules based on the linker and ligand portions as specifically depicted in attached to an oligonucleotide moiety as also depicted herein, this ETX021 product may alternatively further comprise, or consist essentially of, molecules wherein the linker and ligand portions are essentially as depicted in attached to an oligonucleotide moiety but having the F substituent as shown in on the cyclo-octyl ring replaced by a substituent occurring as a result of hydrolytic displacement, such as an OH substituent. In this way, (a) ETX021 can consist essentially of molecules having linker and ligand portions specifically as depicted in , with a F substituent on the cyclo-octyl ring; or (b) ETX021 can consist essentially of molecules having linker and ligand portions essentially as depicted in but having the F substituent as shown in on the cyclo-octyl ring replaced by a substituent occurring as a result of hydrolytic displacement, such as an OH substituent, or (c) ETX021 can comprise a mixture of molecules as defined in (a) and/or (b).
. Total bilirubin concentration in serum from animals treated with a single 1 mg/kg dose of ETX023. Each point represents the mean and standard deviation of 3 animals. The dotted lines show the range of values considered normal for this species (Park et al. 2016 Reference values of clinical pathology parameter in cynomolgus monkeys used in preclinical studies. Lab Anim Res 32:79-86.)
. Blood urea nitrogen (BUN) concentration from animals treated with a single 1 mg/kg dose of ETX023. Each point represents the mean and standard deviation of 3 animals. The dotted lines show the range of values considered normal for this species (Park et al. 2016 Reference values of clinical pathology parameter in cynomolgus monkeys used in preclinical studies. Lab Anim Res 32:79-86.)
. Creatinine (CREA) concentration from animals treated with a single 1 mg/kg dose of ETX023. Each point represents the mean and standard deviation of 3 animals. The dotted lines show the range of values considered normal for this species (Park et al. 2016 Reference values of clinical pathology parameter in cynomolgus monkeys used in preclinical studies. Lab Anim Res 32:79-86.)
A depicts a tri-antennary GalNAc (N-acetylgalactosamine) unit. B depicts an alternative tri-antennary GalNAc according to one embodiment of the invention, showing variance in linking groups. A depicts tri-antennary GalNAc-conjugated siRNA according to the invention, showing variance in the linking groups. B depicts a genera of tri-antennary GalNAc-conjugated siRNAs according to one embodiment of the invention. C depicts a genera of bi-antennary GalNAc-conjugated siRNAs according to one embodiment of the invention, showing variance in the linking groups. D depicts a genera of bi-antennary GalNAc-conjugated siRNAs according to another embodiment of the invention, showing variance in the linking groups. A depicts another embodiment of the tri-antennary GalNAc-conjugated siRNA according to one embodiment of the invention. B depicts a variant shown in A , having an alternative branching GalNAc conjugate. C depicts a genera of tri-antennary GalNAc-conjugated siRNAs according to one embodiment of the invention, showing variance in the linking groups. D depicts a genera of bi-antennary GalNAc-conjugated siRNAs according to one embodiment the invention, showing variance in the linking groups.
shows the detail of formulae I to XV below.
A shows the underlying nucleotide sequences for the sense (SS) and antisense (AS) strands of construct ETX001 as described herein (SEQ ID NOs: 1 and 2, respectively). For ETX001 a galnac linker is attached to the 5′ end region of the sense strand in use (not depicted in A ). For ETX001 the galnac linker is attached and as shown in . Reference to A in the subsequent paragraphs is reference to the sequence, construct design and modification pattern of ETX001.
iaia as shown at the 3′ end region of the sense strand in A represents (i) two abasic nucleotides provided as the penultimate and terminal nucleotides at the 3′ end region of the sense strand, (ii) wherein a 3′-3′ reversed linkage is provided between the antepenultimate nucleotide (namely A at position 21 of the sense strand, wherein position 1 is the terminal 5′ nucleotide of the sense strand, namely terminal G at the 5′end region of the sense strand) and the adjacent penultimate abasic residue of the sense strand, and (iii) the linkage between the terminal and penultimate abasic nucleotides is 5′-3′ when reading towards the 3′ end region comprising the terminal and penultimate abasic nucleotides.
For the sense strand of A , when reading from position 1 of the sense strand (which is the terminal 5′ nucleotide of the sense strand, namely terminal G at the 5′end region of the sense strand), then: (i) the nucleotides at positions 1 to 6, 8, and 12 to 21 have sugars that are 2′ O-methyl modified, (ii) the nucleotides at positions 7, and 9 to 11 have sugars that are 2′ F modified, (iii) the abasic nucleotides have sugars that have H at positions 1 and 2.
For the antisense strand of A , when reading from position 1 of the antisense strand (which is the terminal 5′ nucleotide of the antisense strand, namely terminal U at the 5′end region of the antisense strand), then: (i) the nucleotides at positions 1, 3 to 5, 7, 10 to 13, 15, 17 to 23 have sugars that are 2′ O-methyl modified, (ii) the nucleotides at positions 2, 6, 8, 9, 14, 16 have sugars that are 2′ F modified.
ETX003 as described herein has the same underlying sequence and galnac linker and attachment as depicted for ETX001 in A , but without the terminal iaia motif and with a fully alternating 2′ O-methyl/2′F modification pattern on the sugars of the nucleotides. For the sense strand, the fully alternating modification pattern starts with a 2′F modification at position 1 at the 5′ end region of the sense strand. For the antisense strand, the fully alternating modification pattern starts with a 2′ O-methyl modification at position 1 at the 5′ end region of the antisense strand.
B shows the underlying nucleotide sequences for the sense (SS) and antisense (AS) strands of construct ETX005 as described herein (SEQ ID NOs: 7 and 8, respectively). For ETX005 a galnac linker is attached to the 3′ end region of the sense strand in use (not depicted in B ). For ETX005 the galnac linker is attached and as shown in . Reference to B in the subsequent paragraphs is reference to the sequence, construct design and modification pattern of ETX005.
iaia as shown at the 5′ end region of the sense strand in B represents (i) two abasic nucleotides provided as the penultimate and terminal nucleotides at the 5′ end region of the sense strand, (ii) wherein a 5′-5′ reversed linkage is provided between the antepenultimate nucleotide (namely G at position 1 of the sense strand, not including the iaia motif at the 5′ end region of the sense strand in the nucleotide position numbering on the sense strand) and the adjacent penultimate abasic residue of the sense strand, and (iii) the linkage between the terminal and penultimate abasic nucleotides is 3′-5′ when reading towards the 5′ end region comprising the terminal and penultimate abasic nucleotides.
For the sense strand of B , when reading from position 1 of the sense strand (which is the terminal 5′ nucleotide of the sense strand, namely terminal G at the 5′end region of the sense strand, not including the iaia motif at the 5′ end region of the sense strand in the nucleotide position numbering on the sense strand), then: (i) the nucleotides at positions 1 to 6, 8, and 12 to 21 have sugars that are 2′ O-methyl modified, (ii) the nucleotides at positions 7, and 9 to 11 have sugars that are 2′ F modified, (iii) the abasic nucleotides have sugars that have H at positions 1 and 2.
For the antisense strand of B , when reading from position 1 of the antisense strand (which is the terminal 5′ nucleotide of the antisense strand, namely terminal U at the 5′end region of the antisense strand), then: (i) the nucleotides at positions 1, 3 to 5, 7, 10 to 13, 15, 17 to 23 have sugars that are 2′ O-methyl modified, (ii) the nucleotides at positions 2, 6, 8, 9, 14, 16 have sugars that are 2′ F modified.
ETX007 as described herein has the same underlying sequence and galnac linker and attachment as depicted for ETX005 in B , but without the terminal iaia motif and with a fully alternating 2′ O-methyl/2′F modification pattern on the sugars of the nucleotides. For the sense strand, the fully alternating modification pattern starts with a 2′F modification at position 1 at the 5′ end region of the sense strand. For the antisense strand, the fully alternating modification pattern starts with a 2′ O-methyl modification at position 1 at the 5′ end region of the antisense strand.
A shows the underlying nucleotide sequences for the sense (SS) and antisense (AS) strands of construct ETXO10 as described herein (SEQ ID NOs: 3 and 4, respectively). For ETXO10 a galnac linker is attached to the 5′ end region of the sense strand in use (not depicted in A ). For ETXO10 the galnac linker is attached and as shown in . Reference to A in the subsequent paragraphs is reference to the sequence, construct design and modification pattern of ETXO10.
iaia as shown at the 3′ end region of the sense strand in A represents (i) two abasic nucleotides provided as the penultimate and terminal nucleotides at the 3′ end region of the sense strand, (ii) wherein a 3′-3′ reversed linkage is provided between the antepenultimate nucleotide (namely A at position 21 of the sense strand, wherein position 1 is the terminal 5′ nucleotide of the sense strand, namely terminal A at the 5′end region of the sense strand) and the adjacent penultimate abasic residue of the sense strand, and (iii) the linkage between the terminal and penultimate abasic nucleotides is 5′-3′ when reading towards the 3′ end region comprising the terminal and penultimate abasic nucleotides.
For the sense strand of A , when reading from position 1 of the sense strand (which is the terminal 5′ nucleotide of the sense strand, namely terminal A at the 5′end region of the sense strand), then: (i) the nucleotides at positions 1, 2, 4, 6, 8, 12, 14, 15, 17, 19 to 21 have sugars that are 2′ O-methyl modified, (ii) the nucleotides at positions 3, 5, 7, 9 to 11, 13, 16, 18 have sugars that are 2′ F modified, (iii) the abasic nucleotides have sugars that have H at positions 1 and 2.
For the antisense strand of A , when reading from position 1 of the antisense strand (which is the terminal 5′ nucleotide of the antisense strand, namely terminal U at the 5′end region of the antisense strand), then: (i) the nucleotides at positions 1, 4, 6, 7, 9, 11 to 13, 15, 17, 19 to 23 have sugars that are 2′ O-methyl modified, (ii) the nucleotides at positions 2, 3, 5, 8, 10, 14, 16, 18 have sugars that are 2′ F modified, (iii) the penultimate and terminal T nucleotides at positions 24, 25 at the 3′ end region of the antisense strand have sugars that have H at position 2.
ETX012 as described herein has the same underlying sequence and galnac linker and attachment as depicted for ETXO10 in A , but without the terminal iaia motif and with a fully alternating 2′ O-methyl/2′F modification pattern on the sugars of the nucleotides (with the exception of the terminal T nucleotides that have H at position 2). For the sense strand, the fully alternating modification pattern starts with a 2′F modification at position 1 at the 5′ end region of the sense strand. For the antisense strand, the fully alternating modification pattern starts with a 2′ O-methyl modification at position 1 at the 5′ end region of the antisense strand.
B shows the underlying nucleotide sequences for the sense (SS) and antisense (AS) strands of construct ETX014 as described herein (SEQ ID NOs: 9 and 10, respectively). For ETX014 a galnac linker is attached to the 3′ end region of the sense strand in use (not depicted in B ). For ETX014 the galnac linker is attached and as shown in . Reference to B in the subsequent paragraphs is reference to the sequence, construct design and modification pattern of ETX014.
iaia as shown at the 5′ end region of the sense strand in B represents (i) two abasic nucleotides provided as the penultimate and terminal nucleotides at the 5′ end region of the sense strand, (ii) wherein a 5′-5′ reversed linkage is provided between the antepenultimate nucleotide (namely A at position 1 of the sense strand, not including the iaia motif at the 5′ end region of the sense strand in the nucleotide position numbering on the sense strand) and the adjacent penultimate abasic residue of the sense strand, and (iii) the linkage between the terminal and penultimate abasic nucleotides is 3′-5′ when reading towards the 5′ end region comprising the terminal and penultimate abasic nucleotides.
For the sense strand of B , when reading from position 1 of the sense strand (which is the terminal 5′ nucleotide of the sense strand, namely terminal A at the 5′end region of the sense strand, not including the iaia motif at the 5′ end region of the sense strand in the nucleotide position numbering on the sense strand), then: (i) the nucleotides at positions 1, 2, 4, 6, 8, 12, 14, 15, 17, 19 to 21 have sugars that are 2′ O-methyl modified, (ii) the nucleotides at positions 3, 5, 7, 9 to 11, 13, 16, 18 have sugars that are 2′ F modified, (iii) the abasic nucleotides have sugars that have H at positions 1 and 2.
For the antisense strand of B , when reading from position 1 of the antisense strand (which is the terminal 5′ nucleotide of the antisense strand, namely terminal U at the 5′end region of the antisense strand), then: (i) the nucleotides at positions 1, 4, 6, 7, 9, 11 to 13, 15, 17, 19 to 23 have sugars that are 2′ O-methyl modified, (ii) the nucleotides at positions 2, 3, 5, 8, 10, 14, 16, 18 have sugars that are 2′ F modified, (iii) the penultimate and terminal T nucleotides at positions 24, 25 at the 3′ end region of the antisense strand have sugars that have H at position 2.
ETX016 as described herein has the same underlying sequence and galnac linker and attachment as depicted for ETX014 in B , but without the terminal iaia motif and with a fully alternating 2′ O-methyl/2′F modification pattern on the sugars of the nucleotides (with the exception of the terminal T nucleotides that have H at position 2). For the sense strand, the fully alternating modification pattern starts with a 2′F modification at position 1 at the 5′ end region of the sense strand. For the antisense strand, the fully alternating modification pattern starts with a 2′ O-methyl modification at position 1 at the 5′ end region of the antisense strand.
A shows the underlying nucleotide sequences for the sense (SS) and antisense (AS) strands of construct ETX019 as described herein (SEQ ID NOs: 5 and 6, respectively). For ETX019 a galnac linker is attached to the 5′ end region of the sense strand in use (not depicted in A ). For ETX019 the galnac linker is attached and as shown in . Reference to A in the subsequent paragraphs is reference to the sequence, construct design and modification pattern of ETX019.
iaia as shown at the 3′ end region of the sense strand in A represents (i) two abasic nucleotides provided as the penultimate and terminal nucleotides at the 3′ end region of the sense strand, (ii) wherein a 3′-3′ reversed linkage is provided between the antepenultimate nucleotide (namely A at position 21 of the sense strand, wherein position 1 is the terminal 5′ nucleotide of the sense strand, namely terminal U at the 5′end region of the sense strand) and the adjacent penultimate abasic residue of the sense strand, and (iii) the linkage between the terminal and penultimate abasic nucleotides is 5′-3′ when reading towards the 3′ end region comprising the terminal and penultimate abasic nucleotides.
For the sense strand of A , when reading from position 1 of the sense strand (which is the terminal 5′ nucleotide of the sense strand, namely terminal U at the 5′end region of the sense strand), then: (i) the nucleotides at positions 1 to 6, 8, and 12 to 21 have sugars that are 2′ O-methyl modified, (ii) the nucleotides at positions 7, and 9 to 11 have sugars that are 2′ F modified, (iii) the abasic nucleotides have sugars that have H at positions 1 and 2.
For the antisense strand of A , when reading from position 1 of the antisense strand (which is the terminal 5′ nucleotide of the antisense strand, namely terminal U at the 5′end region of the antisense strand), then: (i) the nucleotides at positions 1, 3 to 5, 7, 8, 10 to 13, 15, 17 to 23 have sugars that are 2′ O-methyl modified, (ii) the nucleotides at positions 2, 6, 9, 14, 16 have sugars that are 2′ F modified.
ETX021 as described herein has the same underlying sequence and galnac linker and attachment as depicted for ETX019 in A , but without the terminal iaia motif and with a fully alternating 2′ O-methyl/2′F modification pattern on the sugars of the nucleotides. For the sense strand, the fully alternating modification pattern starts with a 2′F modification at position 1 at the 5′ end region of the sense strand. For the antisense strand, the fully alternating modification pattern starts with a 2′ O-methyl modification at position 1 at the 5′ end region of the antisense strand.
B shows the underlying nucleotide sequences for the sense (SS) and antisense (AS) strands of construct ETX023 as described herein (SEQ ID NOs: 11 and 12, respectively). For ETX023 a galnac linker is attached to the 3′ end region of the sense strand in use (not depicted in B ). For ETX023 the galnac linker is attached and as shown in . Reference to B in the subsequent paragraphs is reference to the sequence, construct design and modification pattern of ETX023.
iaia as shown at the 5′ end region of the sense strand in B represents (i) two abasic nucleotides provided as the penultimate and terminal nucleotides at the 5′ end region of the sense strand, (ii) wherein a 5′-5′ reversed linkage is provided between the antepenultimate nucleotide (namely U at position 1 of the sense strand, not including the iaia motif at the 5′ end region of the sense strand in the nucleotide position numbering on the sense strand) and the adjacent penultimate abasic residue of the sense strand, and (iii) the linkage between the terminal and penultimate abasic nucleotides is 3′-5′ when reading towards the 5′ end region comprising the terminal and penultimate abasic nucleotides.
For the sense strand of B , when reading from position 1 of the sense strand (which is the terminal 5′ nucleotide of the sense strand, namely terminal U at the 5′end region of the sense strand, not including the iaia motif at the 5′ end region of the sense strand in the nucleotide position numbering on the sense strand), then: (i) the nucleotides at positions 1 to 6, 8, and 12 to 21 have sugars that are 2′ O-methyl modified, (ii) the nucleotides at positions 7, and 9 to 11 have sugars that are 2′ F modified, (iii) the abasic nucleotides have sugars that have H at positions 1 and 2.
For the antisense strand of B , when reading from position 1 of the antisense strand (which is the terminal 5′ nucleotide of the antisense strand, namely terminal U at the 5′end region of the antisense strand), then: (i) the nucleotides at positions 1, 3 to 5, 7, 8, 10 to 13, 15, 17 to 23 have sugars that are 2′ O-methyl modified, (ii) the nucleotides at positions 2, 6, 9, 14, 16 have sugars that are 2′ F modified.
ETX025 as described herein has the same underlying sequence and galnac linker and attachment as depicted for ETX023 in B , but without the terminal iaia motif and with a fully alternating 2′ O-methyl/2′F modification pattern on the sugars of the nucleotides. For the sense strand, the fully alternating modification pattern starts with a 2′F modification at position 1 at the 5′ end region of the sense strand. For the antisense strand, the fully alternating modification pattern starts with a 2′ O-methyl modification at position 1 at the 5′ end region of the antisense strand.
Exemplary linear configuration is shown in , wherein (a) and/or (b) can typically represent connecting bonds or groups, such as phosphate or phosphorothioate groups.
Exemplary branched configuration is shown in .
DETAILED DESCRIPTION
The present invention provides novel, ligand-conjugated oligonucleotide compounds, methods of making these compounds and uses thereof.
Compounds of the invention comprise an oligonucleotide moiety and/or a linker and/or a ligand moiety, or parts thereof, as disclosed herein. Preferably, compounds of the invention comprise an oligonucleotide moiety, a linker and a ligand moiety. These moieties may be covalently bonded together, such that the oligonucleotide moiety is covalently bonded to the ligand moiety via the linker.
It will be understood that compounds of the invention can combine any oligonucleotide moiety as described anywhere herein, and/or any linker as described anywhere herein, and/or any ligand moiety as described anywhere herein.
Exemplary compounds of the invention comprise the following general structure:
•
• wherein: • R 1 at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl; • R 2 is selected from the group consisting of hydrogen, hydroxy, —OC 1-3 alkyl, —C(═O)OC 1-3 alkyl, halo and nitro; • X 1 and X 2 at each occurrence are independently selected from the group consisting of methylene, oxygen and sulfur; • m is an integer of from 1 to 6; • n is an integer of from 1 to 10; • q, r, s, t, v are independently integers from 0 to 4, with the proviso that: • (i) q and r cannot both be 0 at the same time; and • (ii) s, t and v cannot all be 0 at the same time; • Z is an oligonucleotide moiety.
1. Ligand Moiety
Exemplary compounds of the invention comprise a ‘ligand moiety’, as depicted in Formula (I).
In some embodiments, the ligand moiety as depicted in Formula (I) comprises one or more ligands.
In some embodiments, the ligand moiety as depicted in Formula (I) comprises one or more carbohydrate ligands.
In some embodiments, the one or more carbohydrates can be a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and/or polysaccharide.
In some embodiments, the one or more carbohydrates comprise one or more galactose moieties, one or more lactose moieties, one or more N-AcetylGalactosamine moieties, and/or one or more mannose moieties.
In some embodiments, the one or more carbohydrates comprise one or more N-AcetylGalactosamine moieties.
In some embodiments, the compounds as described anywhere herein comprise two or three N-AcetylGalactosamine moieties.
In some embodiments, the one or more ligands are attached in a linear configuration, or in a branched configuration, for example each configuration being respectively attached to a branch point in an overall linker.
Exemplary linear configuration, or branched configurations, of ligand moieties can be depicted as follows, using the nomenclature as further explained in sections 2, 3 and 4 hereinafter.
Exemplary linear configuration is shown in , wherein (a) and/or (b) can typically represent connecting bonds or groups, such as phosphate or phosphorothioate groups.
Exemplary branched configuration is shown in .
In some embodiments, the one or more ligands are attached as a biantennary or triantennary branched configuration. Typically, a triantennary branched configuration can be preferred, such as an N-AcetylGalactosamine triantennary branched configuration.
2. Linker
Exemplary compounds of the invention comprise a ‘linker moiety’, as depicted in Formula (I), that is part of an overall ‘linker’.
As will be further understood in the art, exemplary compounds of the invention comprise an overall linker that is located between the oligonucleotide moiety and the ligand moiety of these compounds. The overall linker, thereby ‘links’ the oligonucleotide moiety and the ligand moiety to each other.
The overall linker is often notionally envisaged as comprising one or more linker building blocks. For example, there is a linker portion that is depicted as the ‘linker moiety’ as represented in Formula (I) positioned adjacent the ligand moiety and attaching the ligand moiety, typically via a branch point, directly or indirectly to the oligonucleotide moiety. The linker moiety as depicted in Formula (I) can also often be referred to as the ‘ligand arm or arms’ of the overall linker. There can also, but not always, be a further linker portion between the oligonucleotide moiety and the branch point, that is often referred to as the ‘tether moiety’ of the overall linker, ‘tethering’ the oligonucleotide moiety to the remainder of the conjugated compound. Such ‘ligand arms’ and/or ‘linker moieties’ and/or ‘tether moieties’ can be envisaged by reference to the linear and/or branched configurations as set out above.
As can be seen from the claims, and the reminder of the patent specification, the scope of the present invention extends to linear or branched configurations, and with no limitation as to the number of individual ligands that might be present. Furthermore, the addressee will also be aware that there are many structures that could be used as the linker moiety, based on the state of the art and the expertise of an oligonucleotide chemist.
The remainder of the overall linker (other than the linker moiety) as set out in the claims, and the remainder of the patent specification, is shown by its chemical constituents in Formula (I), which the inventors consider to be particularly unique to the current invention. In more general terms, however, these chemical constituents could be described as a ‘tether moiety’ as hereinbefore described, wherein the ‘tether moiety’ is that portion of the overall linker which comprises the group of atoms between Z, namely the oligonucleotide moiety, and the linker moiety as depicted in Formula (I).
2.1 Tether Moiety
In relation to Formula (I), the ‘tether moiety’ comprises the group of atoms between Z, namely the oligonucleotide moiety, and the linker moiety.
In some embodiments, R 1 is hydrogen at each occurrence. In some embodiments, R 1 is methyl. In some embodiments, R 1 is ethyl.
In some embodiments, R 2 is hydroxy. In some embodiments, R 2 is halo. In some embodiments, R 2 is fluoro. In some embodiments, R 2 is chloro. In some embodiments, R 2 is bromo. In some embodiments, R 2 is iodo. In some embodiments, R 2 is nitro.
In some embodiments, X 1 is methylene. In some embodiments, X 1 is oxygen. In some embodiments, X 1 is sulfur.
In some embodiments, X 2 is methylene. In some embodiments, X 2 is oxygen. In some embodiments, X 2 is sulfur.
In some embodiments, m=3.
In some embodiments, n=6.
In some embodiments, X 1 is oxygen and X 2 is methylene. In some embodiments, both X 1 and X 2 are methylene.
In some embodiments, q=1, r=2, s=1, t=1, v=1. In some embodiments, q=1, r=3, s=1, t=1, v=1.
In some embodiments, R 1 is hydrogen at each occurrence, n=6, m=3, R 2 is fluoro, X 2 is methylene, v=1, t=1, s=1, X 1 is methylene, q=1 and r=2.
Thus, in some embodiments, exemplary compounds of the invention comprise the following structure:
In some embodiments, R 1 is hydrogen at each occurrence, n=6, m=3, R 2 is fluoro, X 2 is methylene, v=1, t=1, s=1, X 1 is oxygen, q=1 and r=2.
Thus, in some embodiments, exemplary compounds of the invention comprise the following structure:
2.1.1 Alternative Tether Moieties
During the synthesis of compounds of the present invention, alternative tether moiety structures may arise. In some embodiments, alternative tether moieties have a change of one or more atoms in the tether moiety of the overall linker compared to tether moieties described anywhere herein.
In some embodiments, the alternative tether moiety is a compound of Formula (I) as described anywhere herein, wherein R 2 is hydroxy.
In some embodiments, R 1 is hydrogen at each occurrence, n=6, m=3, R 2 is hydroxy, X 2 is methylene, v=1, t=1, s=1, X 1 is methylene, q=1 and r=2.
Thus, in some embodiments, compounds of the invention comprise the following structure:
In some embodiments, R 1 is hydrogen at each occurrence, n=6, m=3, R 2 is hydroxy, X 2 is methylene, v=1, t=1, s=1, X 1 is oxygen, q=1 and r=2.
Thus, in some embodiments, compounds of the invention comprise the following structure:
2.2 Linker Moiety
In relation to Formula (I), the ‘linker moiety’ as depicted in Formula (I) comprises the group of atoms located between the tether moiety as described anywhere herein, and the ligand moiety as described anywhere herein.
In some embodiments:
as depicted in Formula (I) as described anywhere herein is any of Formulae (VIa), (VIb) or (VIc), preferably Formula (VIa):
•
• wherein: • A 1 is hydrogen, or a suitable hydroxy protecting group; • a is an integer of 2 or 3; and • b is an integer of 2 to 5; or
•
• wherein: • A 1 is hydrogen, or a suitable hydroxy protecting group; • a is an integer of 2 or 3; and • c and d are independently integers of 1 to 6; or
•
• wherein: • A 1 is hydrogen, or a suitable hydroxy protecting group; • a is an integer of 2 or 3; and • e is an integer of 2 to 10.
In some embodiments, the moiety:
as depicted in Formula (I) is Formula (VIa):
wherein:
•
• A 1 is hydrogen, or a suitable hydroxy protecting group; • a is 3; and • b is an integer of 3.
In some embodiments, the moiety:
as depicted in Formula (I) as described anywhere herein is Formula (VII):
•
• wherein: • A 1 is hydrogen; • a is an integer of 2 or 3, preferably 3.
3. Oligonucleotide Moiety
Exemplary compounds of the present invention comprise an oligonucleotide moiety, depicted as ‘Z’ in Formula (I).
In some embodiments, Z is:
•
• wherein: • Z 1 , Z 2 , Z 3 , Z 4 are independently at each occurrence oxygen or sulfur; and one the bonds between P and Z 2 , and P and Z 3 is a single bond and the other bond is a double bond.
In some embodiments, the oligonucleotide is an RNA compound capable of modulating expression of a target gene. In some embodiments, the oligonucleotide is an RNA compound capable of inhibiting expression of a target gene.
In some embodiments, the RNA compound comprises an RNA duplex comprising first and second strands, wherein the first strand is at least partially complementary to an RNA sequence of a target gene, and the second strand is at least partially complementary to said first strand, and wherein each of the first and second strands have 5′ and 3′ ends.
In some embodiments, the first strand is at least 80% complementary to an RNA sequence of a target gene, such as at least 85%, at least 90%, at least 91%, at least 92% at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary, such as 100% complementary over the length of the first strand.
In some embodiments, the RNA compound is attached at the 5′ end of its second strand to the adjacent phosphate.
In some embodiments, the RNA compound is attached at the 3′ end of its second strand to the adjacent phosphate.
It will be understood that where the RNA compound is attached at the 5′end of the second strand, the phosphate group connecting the oligonucleotide to the linker moiety (i.e. the ‘P’ connected to Z 1 , Z 2 , Z 3 and Z 4 ) is the naturally occurring phosphate group from the 5′ terminal ribose of the oligonucleotide.
It will be understood that where the RNA compound is attached at the 3′end of the second strand, the phosphate group connecting the oligonucleotide to the linker moiety (i.e. the ‘P’ connected to Z 1 , Z 2 , Z 3 and Z 4 ) is engineered on to the 3′ terminal ribose of the oligonucleotide, to substitute the naturally occurring hydroxy group at the 3′ position.
In some embodiments, the oligonucleotide comprises an RNA duplex which further comprises one or more riboses modified at the 2′ position. In some embodiments, the RNA duplex comprises a plurality of riboses modified at the 2′ position. In some embodiments, the modifications are selected from 2′-O-methyl, 2′-deoxy-fluoro, and 2′-deoxy.
In some embodiments, the oligonucleotide further comprises one or more degradation protective moieties at one or more ends. In some embodiments, said one or more degradation protective moieties are not present at the end of the oligonucleotide strand that carries the ligand moieties. In some embodiments, said one or more degradation protective moieties are not present at the end of the oligonucleotide strand that is adjacent the remainder of the compound as shown in Formula (I), (VII), (IX), (X) or (XI). In some embodiments, said one or more degradation protective moieties is selected from phosphorothioate internucleotide linkages, phosphorodithioate internucleotide linkages and inverted abasic nucleotides, wherein said inverted abasic nucleotides are present at the distal end of the strand that carries the ligand moieties.
4. Exemplary Compounds
Compounds of the invention combine any oligonucleotide moiety as described anywhere herein, any linker as described anywhere herein, and/or any ligand moiety as described anywhere herein, or parts thereof.
In some embodiments, the compound comprises Formula (VIII):
In some embodiments, the compound comprises Formula (IX):
In some embodiments, the compound comprises Formula (X):
In some embodiments, the compound comprises Formula (XI):
4.1 Intermediate Compounds
Compounds of the invention also include intermediate compounds produced or used during the production processes of the invention as described anywhere herein, for the production of compounds as described anywhere herein.
Thus, in some embodiments, the compound comprises Formula (XII):
•
• wherein: • R 1 at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl; • R 2 is selected from the group consisting of hydroxy, halo and nitro; • X 1 and X 2 at each occurrence are independently selected from the group consisting of methylene, oxygen and sulfur; • q, r, s, t, v are independently integers from 0 to 4, with the proviso that: • (i) q and r cannot both be 0 at the same time; and • (ii) s, t and v cannot all be 0 at the same time; • Z is an oligonucleotide moiety.
In some embodiments, the compound comprises Formula (XIIa):
In some embodiments, the compound comprises Formula (XIIb):
In some embodiments, the compound comprises Formula (XIIc):
In some embodiments, the compound comprises Formula (XIId):
In some embodiments, the compound comprises Formula (XIII):
•
• wherein: • R 1 at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl; • m is an integer of from 1 to 6; • n is an integer of from 1 to 10.
In some embodiments, the compound comprises Formula (XIIIa):
In some embodiments, the compound comprises Formula (XIIIb):
In some embodiments, the compound comprises Formula (XIV):
•
• wherein: • R 1 is selected from the group consisting of hydrogen, methyl and ethyl; • R 2 is selected from the group consisting of hydroxy, halo and nitro; • X 2 is selected from the group consisting of methylene, oxygen and sulfur; • s, t, v are independently integers from 0 to 4, with the proviso that s, t and v cannot all be 0 at the same time.
In some embodiments, the compound comprises Formula (XIVa):
In some embodiments, the compound comprises Formula (XIVb):
In some embodiments, the compound comprises Formula (XV):
•
• wherein: • R 1 at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl; • X 1 is selected from the group consisting of methylene, oxygen and sulfur; • q and r are independently integers from 0 to 4, with the proviso that q and r cannot both be 0 at the same time; • Z is an oligonucleotide moiety.
In some embodiments, the compound comprises Formula (XVa):
In some embodiments, the compound comprises Formula (XVb):
5. Compositions
The invention relates to compositions comprising a combination of compounds of the invention.
In some embodiments, the combination comprises a compound comprising an alternative moiety portion as described anywhere herein.
In some embodiments, the compound in the composition comprising the alternative tether moiety as described anywhere herein is present in an amount of 10% by weight or less of said composition.
In some embodiments, the compound in the composition comprising the alternative tether moiety as described anywhere herein is present in an amount in the range of 10 to 15% by weight of said composition.
In some embodiments, the composition comprises a compound of Formula (IV) as described anywhere herein, and a compound of Formula (V) as described anywhere herein. In some embodiments, the compound of Formula (V) as described anywhere herein is present in an amount in the range of 10 to 15% by weight of said composition.
In some embodiments, the composition comprises a compound of Formula (X) as described anywhere herein, and a compound of Formula (XI) as described anywhere herein. In some embodiments, the compound of Formula (XI) as described anywhere herein is present in an amount in the range of 10 to 15% by weight of said composition.
In some embodiments, the composition comprises a compound of Formula (II) as described anywhere herein, and a compound of Formula (III) as described anywhere herein. In some embodiments, the compound of Formula (III) as described anywhere herein is present in an amount in the range of 10 to 15% by weight of said composition.
In some embodiments, the composition comprises a compound of Formula (VIII) as described anywhere herein, and a compound of Formula (IX) as described anywhere herein.
In some embodiments, the compound of Formula (IX) as described anywhere herein is present in an amount in the range of 10 to 15% by weight of said composition.
6. Production Processes
The invention further provides a process of preparing a compound as described anywhere herein. The invention further provides a process of preparing a composition as described anywhere herein.
In some embodiments, the process comprises reacting compounds of Formulae (XII) and (XIII):
•
• wherein: • R 1 at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl; • R 2 is selected from the group consisting of hydrogen, hydroxy, —OC 1-3 alkyl, —C(═O)OC 1-3 alkyl, halo and nitro; • X 1 and X 2 at each occurrence are independently selected from the group consisting of methylene, oxygen and sulfur; • m is an integer of from 1 to 6; • n is an integer of from 1 to 10; • q, r, s, t, v are independently integers from 0 to 4, with the proviso that: • (i) q and r cannot both be 0 at the same time; and • (ii) s, t and v cannot all be 0 at the same time; • Z is oligonucleotide moiety; • and where appropriate carrying out deprotection of the ligand and/or annealing of a second strand for the oligonucleotide moiety.
In some embodiments, compound of Formula (XII) is Formula (XIIa):
and compound of Formula (XIII) is Formula (XIIIa):
wherein the oligonucleotide comprises an RNA duplex comprising first and second strands, wherein the first strand is at least partially complementary to an RNA sequence of a target gene, and the second strand is at least partially complementary to said first strand, and wherein each of the first and second strands have 5′ and 3′ ends, and wherein said RNA duplex is attached at the 5′ end of its second strand to the adjacent phosphate.
In some embodiments, Formula (XII) is Formula (XIIb):
and compound of Formula (XIII) is Formula (XIIIa):
wherein the oligonucleotide comprises an RNA duplex comprising first and second strands, wherein the first strand is at least partially complementary to an RNA sequence of a target gene, and the second strand is at least partially complementary to said first strand, and wherein each of the first and second strands have 5′ and 3′ ends, and wherein said RNA duplex is attached at the 5′ end of its second strand to the adjacent phosphate.
In some embodiments, compound of Formula (XII) is Formula (XIIc):
and compound of Formula (XIII) is Formula (XIIIa):
wherein the oligonucleotide comprises an RNA duplex comprising first and second strands, wherein the first strand is at least partially complementary to an RNA sequence of a target gene, and the second strand is at least partially complementary to said first strand, and wherein each of the first and second strands have 5′ and 3′ ends, and wherein said RNA duplex is attached at the 3′ end of its second strand to the adjacent phosphate.
In some embodiments, compound of Formula (XII) is Formula (XIId):
and compound of Formula (XIII) is Formula (XIIIa):
wherein the oligonucleotide comprises an RNA duplex comprising first and second strands, wherein the first strand is at least partially complementary to an RNA sequence of a target gene, and the second strand is at least partially complementary to said first strand, and wherein each of the first and second strands have 5′ and 3′ ends, and wherein said RNA duplex is attached at the 3′ end of its second strand to the adjacent phosphate.
In some embodiments, compound of Formula (XIIIa) is Formula (XIIIb):
In some embodiments, a compound of Formula (XII) is prepared by reacting compounds of Formulae (XIV) and (XV):
•
• R 1 at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl; • R 2 is selected from the group consisting of hydrogen, hydroxy, —OC 1-3 alkyl, —C(═O)OC 1-3 alkyl, halo and nitro; • X 1 and X 2 at each occurrence are independently selected from the group consisting of methylene, oxygen and sulfur; • q, r, s, t, v are independently integers from 0 to 4, with the proviso that: • (i) q and r cannot both be 0 at the same time; and • (ii) s, t and v cannot all be 0 at the same time; • Z is an oligonucleotide moiety.
In some embodiments, compound of Formula (XIV) is either Formula (XIVa) or Formula (XIVb):
and compound of Formula (XV) is either Formula (XVa) or Formula (XIVb):
wherein the oligonucleotide comprises an RNA duplex comprising first and second strands, wherein the first strand is at least partially complementary to an RNA sequence of a target gene, and the second strand is at least partially complementary to said first strand, and wherein each of the first and second strands have 5′ and 3′ ends, and wherein (i) said RNA duplex is attached at the 5′ end of its second strand to the adjacent phosphate in Formula (XVa), or (ii) said RNA duplex is attached at the 3′ end of its second strand to the adjacent phosphate in Formula (XVb).
7. Uses
The invention relates to use of the compounds and compositions as described anywhere herein.
The present invention also relates to uses of a compound as described anywhere herein, for the preparation of another compound as described anywhere herein.
The present invention further relates to uses of a composition as described anywhere herein, for the preparation of another composition as described anywhere herein.
In some embodiments, the use is for the preparation of a compound or a composition as described anywhere herein, wherein R 2 ═F.
In some embodiments, the use is for the preparation of a compound or a composition as described anywhere herein, comprising an alternative tether moiety as described anywhere herein. In some embodiments, the use is for the preparation of a compound or a composition as described anywhere herein, wherein R 2 ═OH.
The present invention relates to use of a compound of Formula (XII) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein. The present invention relates to use of a compound of Formula (XIII) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein. The present invention relates to use of a compound of Formula (XIV) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein. The present invention relates to use of a compound of Formula (XV) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein.
The present invention relates to use of a compound of Formula (XIIa) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein. The present invention relates to use of a compound of Formula (XIIb) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein. The present invention relates to use of a compound of Formula (XIIc) as described anywhere herein, for the preparation of a compound as described anywhere herein and/or a composition as described anywhere herein. The present invention relates to use of a compound of Formula (XIId) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein. The present invention relates to use of a compound of Formula (XIIIa) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein. The present invention relates to use of a compound of Formula (XIIIb) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein. The present invention relates to use of a compound of Formula (XIVa) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein. The present invention relates to use of a compound of Formula (XIVb) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein. The present invention relates to use of a compound of Formula (XVa) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein. The present invention relates to use of a compound of Formula (XVb) as described anywhere herein, for the preparation of a compound as described anywhere herein, and/or a composition as described anywhere herein.
The invention relates to a compound or composition obtained, or obtainable by a process as described anywhere herein.
The invention relates to therapeutic uses of the compounds and compositions described anywhere herein.
Thus, the present invention relates to a pharmaceutical composition comprising a compound as described anywhere herein, together with a pharmaceutically acceptable carrier, diluent or excipient. The present invention relates to a pharmaceutical composition comprising a composition as described anywhere herein, together with a pharmaceutically acceptable carrier, diluent or excipient.
The present invention also relates to a compound as described anywhere herein, for use in therapy. The present invention also relates to a composition as described anywhere herein, for use in therapy.
Suitable dosages, formulations, administration routes, compositions, dosage forms, combinations with other therapeutic agents, pro-drug formulations are also encompassed by the present invention.
The compounds of the invention may be utilized as research reagents for, for example, diagnostics, therapeutics and prophylaxis.
In therapy, compounds of the invention may be used to specifically modulate the synthesis of a target protein in a cell. This can be achieved by degrading, silencing or inhibiting the mRNA of said target protein, thereby preventing the formation of said protein. Alternatively, compounds of the invention may be used to modulate a non-coding DNA or RNA molecule exerting a regulatory effect on mechanisms within a cell in cells and experimental animals thereby facilitating functional analysis of the target or an appraisal of its usefulness as a target for therapeutic intervention.
In preferred embodiments, target protein is in a target cell that comprises asialoglycoprotein receptors (ASPGR) on the surface, such as liver cells, in particular hepatocytes.
Thus, compounds of the invention may be used as a therapy in an animal or a human, suspected of having a disease or disorder, which can be alleviated or treated by modulating a DNA or RNA encoding a mammalian target polypeptide in said animal or human.
In preferred embodiments the target nucleic acid is a gene, a messenger RNA (mRNA) or micro RNA (miRNA).
Further provided are methods of treating a mammal, such as treating a human, suspected of having or being prone to a disease or condition, by administering a therapeutically or prophylactically effective amount of one or more of the compounds or compositions of the invention.
The invention also provides for the use of the compound or conjugate of the invention as described for the manufacture of a medicament for the treatment of a disorder or for a method of the treatment of as a disorder affected by the modulation of a target nucleic acid.
The invention also provides for a method for treating a disorder, said method comprising administering a compound according to the invention and/or a pharmaceutical composition according to the invention to a patient in need thereof.
Examples of disorders to be treated are liver diseases such as hepatitis (including viral hepatitis, such as HBV or HCV), hepatic steatosis, atherosclerosis, hyperlipidemia, hypercholesterolemia, familiar hypercholesterolemia e.g. gain of function mutations in Apolipoprotein B, HDL/LDL cholesterol imbalance, dyslipidemias, e.g., familial hyperlipidemia (FCHL), acquired hyperlipidemia, statin-resistant hypercholesterolemia, coronary artery disease (CAD), and coronary heart disease (CHD), cirrhosis and cancer.
8. Definitions
Unless defined otherwise, all terms of art, notations and other technical and scientific terms or terminology used herein are intended to have the same meaning as is commonly understood by one of ordinary skill in the art to which the claimed subject matter pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and/or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art.
It is to be understood that this invention is not limited to particular compositions or biological systems, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the content clearly dictates otherwise.
The term “about” as used herein refers to the usual error range for the respective value readily known to the skilled person in this technical field. Reference to “about” a value or parameter herein includes (and describes) embodiments that are directed to that value or parameter per se.
It is understood that aspects and embodiments of the invention described herein include “comprising,” “consisting,” and “consisting essentially of” aspects and embodiments.
As used herein, the term “and/or” refers to any one of the items, any combination of the items, or all of the items with which the term is associated. For instance, the phrase “A, B, and/or C” is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or B; A or C; B or C; A and B; A and C; B and C; A and B or C; B and A or C; C and A or B; A (alone); B (alone); and C (alone).
9. EXAMPLES
The invention will be more fully understood by reference to the following examples. They should not, however, be construed as limiting the scope of the invention. It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims.
The following constructs are used in the examples:
TABLE 1
Target ID Sense Sequence 5′ → 3′ Antisense Sequence 5′ → 3′
hsHAO1 ETX003 (ET-GalNAc-T1N3)(MFCO)(NH- usAfsuAfuUfuCfcAfgGfaUfgAfaAfg
DEG)GfaCfuUfuCfaUfcCfuGfgAfaAfuAfsusAf UfcsCfsa
(SEQ ID NO: 13) (SEQ ID NO: 14)
hsHAO1 ETX005 (invabasic)(invabasic)gsascuuuCfaUfCfCfuggaaauasusa usAfsuauUfuCfCfaggaUfgAfaagucs
(NHC6)(MFCO)(ET-GalNAc-T1N3) csa
(SEQ ID NO: 7) (SEQ ID NO: 8)
hsHAO1 ETX001 (ET-GalNAc-T1N3)(MFCO)(NH- usAfsuauUfuCfCfaggaUfgAfaagucs
DEG)gacuuuCfaUfCfCfuggaaauasusa(invabasic)(invabasic) csa
(SEQ ID NO: 1) (SEQ ID NO: 2)
hsHAO1 ETX007 GfsasCfuUfuCfaUfcCfuGfgAfaAfuAfuAf(NHC6)(MFCO)(ET- usAfsuAfuUfuCfcAfgGfaUfgAfaAfg
GalNAc-T1N3) UfcsCfsa
(SEQ ID NO: 19) (SEQ ID NO: 20)
hsC5 ETX014 (invabasic)(invabasic)asasGfcAfaGfaUfAfUfuUfuuAfuAfaua usAfsUfuAfuaAfaAfauaUfcUfuGfcu
(NHC6)(MFCO)(ET-GalNAc-T1N3) ususudTdT
(SEQ ID NO: 9) (SEQ ID NO: 10)
hsC5 ETX010 (ET-GalNAc-T1N3)(MFCO)(NH- usAfsUfuAfuaAfaAfauaUfcUfuGfcu
DEG)aaGfcAfaGfaUfAfUfuUfuuAfuAfasusa(invabasic) ususudTdT
(invabasic) (SEQ ID NO: 4)
(SEQ ID NO: 3)
hsC5 ETX012 (ET-GalNAc-T1N3)(MFCO)(NH- usAfsuUfaUfaAfaAfaUfaUfcUfuGfc
DEG)AfaGfcAfaGfaUfaUfuUfuUfaUfaAfsusAf UfusUfsudTdT
(SEQ ID NO: 15) (SEQ ID NO: 16)
hsC5 ETX012 (ET-GalNAc-T1N3)(MFCO)(NH- usAfsuUfaUfaAfaAfaUfaUfcUfuGfc
(pure DEG)AfaGfcAfaGfaUfaUfuUfuUfaUfaAfsusAf UfusUfsudTdT
FLP) (SEQ ID NO: 15) (SEQ ID NO: 16)
hsC5 ETX012 (ET-GalNAc-T1N3)(MFCO)(NH- usAfsuUfaUfaAfaAfaUfaUfcUfuGfc
(pure- DEG)AfaGfcAfaGfaUfaUfuUfuUfaUfaAfsusAf UfusUfsudTdT
2Da) (SEQ ID NO: 15) (SEQ ID NO: 16)
hsC5 ETX016 AfsasGfcAfaGfaUfaUfuUfuUfaUfaAfuAf(NHC6)(MFCO)(ET- usAfsuUfaUfaAfaAfaUfaUfcUfuGfc
GalNAc-T1N3) UfusUfsudTdT
(SEQ ID NO: 21) (SEQ ID NO: 22)
hsTTR ETX019 (ET-GalNAc-T1N3)(MFCO)(NH- usCfsuugGfuuAfcaugAfaAfucccasu
DEG)ugggauUfuCfAfUfguaaccaasgsa(invabasic)(invabasic) sc
(SEQ ID NO: 5) (SEQ ID NO: 6)
hsTTR ETX021 (ET-GalNAc-T1N3)(MFCO)(NH- usCfsuUfgGfuUfaCfaUfgAfaAfuCfc
DEG)UfgGfgAfuUfuCfaUfgUfaAfcCfaAfsgsAf CfasUfsc
(SEQ ID NO: 17) (SEQ ID NO: 18)
hsTTR ETX023 (invabasic)(invabasic)usgsggauUfuCfAfUfguaaccaaga usCfsuugGfuuAfcaugAfaAfucccasu
(NHC6)(MFCO)(ET-GalNAc-T1N3) sc
(SEQ ID NO: 11) (SEQ ID NO: 12)
hsTTR ETX025 UfsgsGfgAfuUfuCfaUfgUfaAfcCfaAfgAf(NHC6)(MFCO)(ET- usCfsuUfgGfuUfaCfaUfgAfaAfuCfc
GalNAc-T1N3) CfasUfsc
(SEQ ID NO: 23) (SEQ ID NO: 24)
In Table 1 the components in brackets having the following nomenclature (ET-GalNAc-T1N3), (MFCO), and (NH-DEG) are descriptors of elements of the linkers, and the complete corresponding linker structures are shown in and herein. This correspondence of abbreviation to actual linker structure similarly applies to all other references of the above abbreviations herein.
Reference to (invabasic)(invabasic) refers to nucleotides in an overall polynucleotide which are the terminal 2 nucleotides which have sugar moieties that are (i) abasic, and (ii) in an inverted configuration, whereby the bond between the penultimate nucleotide and the antepenultimate nucleotide has a reversed linkage, namely either a 5-5 or a 3-3 linkage. Again, this similarly applies to all other references to (invabasic)(invabasic) herein.
TABLE 1A
Linker plus ligand
Target ID Short Descriptor SiRNA as Table 1
hsHAO1 ETX003 5′-GalNAc T1b alternating Linker + ligand as
hsHAO1 ETX005 3′-GalNAc T1a inverted abasic Linker + ligand as
hsHAO1 ETX001 5′-GalNAc T1b inverted abasic Linker + ligand as
hsHAO1 ETX007 3′-GalNAc T1a alternating Linker + ligand as
hsC5 ETX014 3′-GalNAc T1a inverted abasic Linker + ligand as
hsC5 ETX010 5′-GalNAc T1b inverted abasic Linker + ligand as
hsC5 ETX012 5′-GalNAc T1b alternating Linker + ligand as
hsC5 ETX012 5′-GalNAc T1b alternating Linker + ligand as
(pure FLP)
hsC5 ETX012 5′-GalNAc T1b alternating Linker + ligand as
(pure - 2Da)
hsC5 ETX016 3′-GalNAc T1a alternating Linker + ligand as
hsTTR ETX019 5′-GalNAc T1b inverted abasic Linker + ligand as
hsTTR ETX021 5′-GalNAc T1b alternating Linker + ligand as
hsTTR ETX023 3′-GalNAc T1a inverted abasic Linker + ligand as
hsTTR ETX025 3′-GalNAc T1a alternating Linker + ligand as
It should also be understood as already explained herein with reference to / , that where appropriate for the linker portions as shown in / which can be present in any of products ETX001, ETX003, ETX005, ETX007, ETXO10, ETX012, ETX014, ETX016, ETX019, ETX021, ETX023 and ETX025 according to the present invention, that while these products can include molecules based on the linker and ligand portions as specifically depicted in / attached to an oligonucleotide moiety as also depicted herein, these products may alternatively further comprise, or consist essentially of, molecules wherein the linker and ligand portions are essentially as depicted in / attached to an oligonucleotide moiety but having the F substituent as shown in / on the cyclo-octyl ring replaced by a substituent occurring as a result of hydrolytic displacement, such as an OH substituent. In this way, (a) these products can consist essentially of molecules having linker and ligand portions specifically as depicted in / , with a F substituent on the cyclo-octyl ring; or (b) these products can consist essentially of molecules having linker and ligand portions essentially as depicted in / but having the F substituent as shown in / on the cyclo-octyl ring replaced by a substituent occurring as a result of hydrolytic displacement, such as an OH substituent, or (c) these products can comprise a mixture of molecules as defined in (a) or (b).
The following control constructs are also used in the examples:
TABLE 2
Target ID Sense Sequence 5′ → 3′ Antisense Sequence 5′ → 3′
F-Luc XD- cuuAcGcuGAGuAcuucGAdTsdT UCGAAGuACUcAGCGuAAGdTsdT
00914 (SEQ ID NO: 37) (SEQ ID NO: 38)
hsFVII XD- AGAuAuGcAcAcAcAcGGAdTsdT UCCGUGUGUGUGcAuAUCUdTsdT
03999 (SEQ ID NO: 39) (SEQ ID NO: 40)
hsAHSA1 XD- uscsUfcGfuGfgCfcUfuAfaUfgAfaAf(invdT) UfsUfsuCfaUfuAfaGfgCfcAfcGfaGfasusu
15421 (SEQ ID NO: 41) (SEQ ID NO: 42)
ABBREVIATIONS
•
• AHSA1 Activator of heat shock protein ATPase1 • ASGR1 Asialoglycoprotein Receptor 1 • ASO Antisense oligonucleotide • bDNA branched DNA • bp base-pair • C5 complement C5 • conc. concentration • ctrl. control • CV coefficient of variation • dG, dC, dA, dT DNA residues • F Fluoro • FCS fetal calf serum • GalNAc N-Acetylgalactosamine • GAPDH Glyceraldehyde 3-phosphate dehydrogenase • G, C, A, U RNA residues • g, c, a, u 2′-O-Methyl modified residues • Gf, Cf, Af, Uf 2′-Fluoro modified residues • h hour • HAO1 Hydroxyacid Oxidase 1 • HPLC High performance liquid chromatography • Hs Homo sapiens • IC50 concentration of an inhibitor where the response is reduced by 50% • ID identifier • KD knockdown • LF2000 Lipofectamine2000 • M molar • Mf Macaca fascicularis • min minute • MV mean value • n.a. or N/A not applicable • NEAA non-essential amino acid • nt nucleotide • QC Quality control • QG2.0 QuantiGene 2.0 • RLU relative light unit • RNAi RNA interference • RT room temperature • s Phosphorothioate backbone modification • SAR structure-activity relationship • SD standard deviation • siRNA small interfering RNA • TTR Transthyretin
9.1 Example 1
Summary
GalNAc-siRNAs targeting either hsHAO1, hsC5 or hsTTR mRNA were synthesized and QC-ed. The entire set of siRNAs (except siRNAs targeting HAG1) was first studied in a dose-response setup in HepG2 cells by transfection using RNAiMAX, followed by a dose-response analysis in a gymnotic free uptake setup in primary human hepatocytes.
Direct incubation of primary human hepatocytes with GalNAc-siRNAs targeting hsHAO1, hsC5 or hsTTR mRNA resulted in dose-dependent on-target mRNA silencing to varying degrees.
Aim of Study
The aim of this set of experiments was to analyze the in vitro activity of different GalNAc-ligands in the context of siRNAs targeting three different on-targets, namely hsHAO1, hsC5 or hsTTR mRNA.
Work packages of this study included (i) assay development to design, synthesize and test bDNA probe sets specific for each and every individual on-target of interest, (ii) to identify a cell line suitable for subsequent screening experiments, (iii) dose-response analysis of potentially all siRNAs (by transfection) in one or more human cancer cell lines, and (iv) dose-response analysis of siRNAs in primary human hepatocytes in a gymnotic, free uptake setting. In both settings, IC50 values and maximal inhibition values should be calculated followed by ranking of the siRNA study set according to their potency.
Material and Methods
Oligonucleotide Synthesis
Standard solid-phase synthesis methods were used to chemically synthesize siRNAs of interest (see Table 1) as well as controls (see Table 2).
Cell Culture and In-Vitro Transfection Experiments
Cell culture, transfection and QuantiGene2.0 branched DNA assay are described below, and siRNA sequences are listed in Tables 1 and 2. HepG2 cells were supplied by American Tissue Culture Collection (ATCC) (HB-8065, Lot #: 63176294) and cultured in ATCC-formulated Eagle's Minimum Essential Medium supplemented to contain 10% fetal calf serum (FCS). Primary human hepatocytes (PHHs) were sourced from Primacyt (Schwerin, Germany) (Lot #: CyHufl9009HEc). Cells are derived from a malignant glioblastoma tumor by explant technique. All cells used in this study were cultured at 37° C. in an atmosphere with 5% CO 2 in a humidified incubator.
For transfection of HepG2 cells with hsC5 or hsTTR targeting siRNAs (and controls), cells were seeded at a density of 20.000 cells/well in regular 96-well tissue culture plates. Transfection of cells with siRNAs was carried out using the commercially available transfection reagent RNAiMAX (Invitrogen/Life Technologies) according to the manufacturer's instructions. 10 point dose-response experiments of 20 candidates (11× hsC5, 9× hsTTR) were done in HepG2 cells with final siRNA concentrations of 24, 6, 1.5, 0.4, 0.1, 0.03, 0.008, 0.002, 0.0005 and 0.0001 nM, respectively.
Dose response analysis in PHHs was done by direct incubation of cells in a gymnotic, free uptake setting starting with 1.5 μM highest final siRNA concentration, followed by 500 nM and from there on going serially down in twofold dilution steps.
Control wells were transfected into HepG2 cells or directly incubated with primary human hepatocytes at the highest test siRNA concentrations studied on the corresponding plate. All control siRNAs included in the different project phases next to mock treatment of cells are summarized and listed in Table 2. For each siRNA and control, at least four wells were transfected/directly incubated in parallel, and individual data points were collected from each well.
After 24 h of incubation with siRNA post-transfection, media was removed and HepG2 cells were lysed in Lysis Mixture (1 volume of lysis buffer plus 2 volumes of nuclease-free water) and then incubated at 53° C. for at least 45 minutes. In the case of PHHs, plating media was removed 5 h post treatment of cells followed by addition of 50 μl of complete maintenance medium per well. Media was exchanged in that way every 24 h up to a total incubation period of 72 h. At either 4 h or 72 h time point, cell culture supernatant was removed followed by addition of 200 μl of Lysis Mixture supplemented with 1:1000 v/v of Proteinase K.
The branched DNA (bDNA) assay was performed according to manufacturer's instructions. Luminescence was read using a 1420 Luminescence Counter (WALLAC VICTOR Light, Perkin Elmer, Rodgau-Jügesheim, Germany) following 30 minutes incubation in the presence of substrate in the dark. For each well, the on-target mRNA levels were normalized to the hsGAPDH mRNA levels. The activity of any siRNA was expressed as percent on-target mRNA concentration (normalized to hsGAPDH mRNA) in treated cells, relative to the mean on-target mRNA concentration (normalized to hsGAPDH mRNA) across control wells.
Assay Development
QuantiGene2.0 branched DNA (bDNA) probe sets were designed and synthesised specific for Homo sapiens GAPDH, AHSA1, hsHAO1, hsC5 and hsTTR. bDNA probe sets were initially tested by bDNA analysis according to manufacturer's instructions, with evaluation of levels of mRNAs of interest in two different lysate amounts, namely 10 μl and 50 μl, of the following human and monkey cancer cell lines next to primary human hepatocytes: SJSA-1, TF1, NCI-H1650, Y-79, Kasumi-1, EAhy926, Caki-1, Colo205, RPTEC, A253, HeLaS3, Hep3B, BxPC3, DU145, THP-1, NCI-H460, IGR37, LS174T, Be(2)-C, SW 1573, NCI-H358, TC71, 22Rv1, BT474, HeLa, KBwt, Panc-1, U87MG, A172, C42, HepG2, LNCaP, PC3, SupT1l, A549, HCT116, HuH7, MCF7, SH-SY5Y, HUVEC, C33A, HEK293, HT29, MOLM 13 and SK-MEL-2. Wells containing only bDNA probe set without the addition of cell lysate were used to monitor technical background and noise signal.
Results
Identification of Suitable Cell Types for Screening of GalNAc-siRNAs
show mRNA expression data for the three on-targets of interest, namely hsC5, hsHAO1 and hsTTR, in lysates of a diverse set of human cancer cell lines plus primary human hepatocytes. Cell numbers per lysate volume are identical with each cell line tested, this is necessary to allow comparisons of expression levels amongst different cell types. shows hsC5 mRNA expression data for all cell types tested.
The identical type of cells were also screened for expression of hsHAO1 mRNA, results are shown in bar diagrams as part of .
Lastly, suitable cell types were identified which would allow for screening of GalNAc-siRNAs targeting hsTTR, respective data are part of .
In summary, mRNA expression levels for all three on-targets of interest are high enough in primary human hepatocytes (PHHs). Further, HepG2 cells could be used to screen GasNAc-siRNAs targeting hsC5 and hsTTR mRNAs, in contrast, no cancer cell line could be identified which would be suitable to test siRNAs specific for hsHAO1 mRNA.
Dose-Response Analysis of hsTTR Targeting GaNAc-siRNAs in HepG2 Cells
Following transfection optimization, HepG2 cells were transfected with the entire set of hsTTR targeting GaNAc-siRNAs (see Table 1) in a dose-response setup using RNAiMAX. The highest final siRNA test concentration was 24 nM, going down in nine fourfold dilution steps. The experiment ended at 4 h and 24 h post transfection of HepG2 cells. Table 3 lists activity data for all hsTTR targeting GalNAC-siRNAs studied.
TABLE 3
Target, incubation time, external ID, IC20/IC50/IC80 values and
maximal inhibition of hsTTR targeting siRNAs in HepG2 cells.
The listing is ordered according to external ID, with 4 h of
incubation listed on top and 24 h of incubation on the bottom.
Incubation External IC20 IC50 IC80 Max.
Target [h] ID [nM] [nM] [nM] Inhib. [%]
hsTTR 4 ETX019 0.206 3.769 #N/A 58.4
hsTTR 4 ETX021 #N/A #N/A #N/A 3.2
hsTTR 4 ETX023 1.338 #N/A #N/A 45.9
hsTTR 4 ETX025 #N/A #N/A #N/A −1.8
hsTTR 24 ETX019 0.002 0.016 0.143 96.0
hsTTR 24 ETX021 0.014 0.053 0.236 94.4
hsTTR 24 ETX023 0.005 0.019 0.081 96.2
hsTTR 24 ETX025 0.018 0.075 0.392 92.9
Results for the 24 h incubation are also shown in A- 4 D .
In general, transfection of HepG2 cells with hsTTR targeting siRNAs results in on-target mRNA silencing spanning in general the entire activity range from 0% silencing to maximal inhibition. Data generated 24 h post transfection are more robust with lower standard variations, as compared to data generated only 4 h post transfection. Further, the extent of on-target knockdown generally increases over time from 4 h up to 24 h of incubation. hsTTR GalNAc-siRNAs have been identified that silence the on-target mRNA >95% with IC50 values in the low double-digit pM range.
Dose-Response Analysis of hsC5 Targeting GalNAc-siRNAs in HepG2 Cells
The second target of interest, hsC5 mRNA, was tested in an identical dose-response setup (with minimally different final siRNA test concentrations, however) by transfection of HepG2 cells using RNAiMAX with GalNAc-siRNAs sharing identical linger/position/GalNAc-ligand variations as with hsTTR siRNAs, but sequences specific for the on-target hsC5 mRNA. Further, included in the test set of study molecules were two extra variants of siRNA XD-30951. One variant was a full-length product (FLP) minus 2 Da fraction, the other one was fractionated, pure FLP.
TABLE 4
Target, incubation time, external ID, IC20/IC50/IC80 values and
maximal inhibition of hsC5 targeting siRNAs in HepG2 cells.
The listing is ordered according to external ID, with 4 h of
incubation listed on top and 24 h of incubation on the bottom.
Incubation External IC20 IC50 IC80 Max.
Target [h] ID [nM] [nM] [nM] Inhib. [%]
C5 4 ETX010 0.125 0.445 #N/A 71.1
C5 4 ETX012 0.087 0.756 #N/A 67.2
C5 4 ETX012 0.157 0.707 #N/A 62.9
(pure FLP
variant)
C5 4 ETX012 0.347 2.795 #N/A 62.2
(pure -
2Da
variant)
C5 4 ETX014 0.595 2.554 #N/A 52.7
C5 4 ETX016 0.466 2.180 #N/A 67.1
C5 24 ETX010 0.003 0.011 0.064 88.3
C5 24 ETX012 0.003 0.013 0.155 84.3
C5 24 ETX012 0.001 0.007 0.115 84.0
(pure FLP
variant)
C5 24 ETX012 0.003 0.014 0.142 85.5
(pure -
2Da
variant)
C5 24 ETX014 0.003 0.014 0.130 88.3
C5 24 ETX016 0.004 0.019 0.220 84.1
Results for the 24 h incubation are also shown in A- 5 D .
There is dose-dependent on-target hsC5 mRNA silencing upon transfection of HepG2 cells with the GalNAc-siRNA set specific for hsC5. Some knockdown can already be detected at 4 h post-transfection of cells, an even higher on-target silencing is observed after a longer incubation period, namely 24 h. hsC5 GalNAc-siRNAs have been identified that silence the on-target mRNA almost 90% with IC50 values in the low single-digit pM range.
Identification of a Primary Human Hepatocyte Batch Suitable for Testing of all GalNAc-siRNAs
The dose-response analysis of the two GalNAc-siRNA sets in human cancer cell line HepG2 should demonstrate (and ensure) that all new GalNAc-/linker/position/cap variants are indeed substrates for efficient binding to AGO2 and loading into RISC, and in addition, able to function in RNAi-mediated cleavage of target mRNA. However, in order to test whether the targeting GalNAc-ligand derivatives allow for efficient uptake into hepatocytes, dose-response analysis experiments should be done in primary human hepatocytes by gymnotic, free uptake setup. Hepatocytes do exclusively express the Asialoglycoprotein receptor (ASGR1) to high levels, and this receptor generally is used by the liver to remove target glycoproteins from circulation. It is common knowledge by now, that certain types of oligonucleotides, e.g. siRNAs or ASOs, conjugated to GalNAc-ligands are recognized by this high turnover receptor and efficiently taken up into the cytoplasm via clathrin-coated vesicles and trafficking to endosomal compartments. Endosomal escape is thought to be the rate-limiting step for oligonucleotide delivery.
An intermediate assay development experiment was done in which different batches of primary human hepatocytes were tested for their expression levels of relevant genes of interest, namely hsC5, hsTTR, hsHAO1, hsGAPDH and hsAHSA1. Primacyt (Schwerin, Germany) provided three vials of different primary human hepatocyte batches for testing, namely BHuf16087, CHF2101 and CyHufl9009. The cells were seeded on collagen-coated 96-well tissue culture plates, followed by incubation of cells for 0 h, 24 h, 48 h and 72 h before cell lysis and bDNA analysis to monitor mRNA levels of interest. shows the absolute mRNA expression data for all three on-targets of interest—hsTTR, hsC5 and hsHAO1—in the primary human hepatocyte batches BHuf16087, CHF2101 and CyHufl9009. mRNA expression levels of hsGAPDH and hsAHSA1 are shown in .
In the left hand column of each data set triplet is BHuf16087, the middle column is CHF2101 and the right hand column is CyHufl9009.
Overall, the mRNA expression of all three on-targets of interest in the primary human hepatocyte batches BHuf16087 and CyHufl9009 are high enough after 72 h to continue with the bDNA assay. Due to the total amount of vials available for further experiments, we continued the experiments with the batch CyHufl9009.
Dose-Response Analysis of hsHAO1 Targeting GalNAc-siRNAs in PHHs
Following the identification of a suitable batch (CyHufl9009) of primary human hepatocytes (PHHs), a gymnotic, free uptake analysis was performed of hsHAO1 targeting GaINAc-siRNAs, listed in Table 1. The highest tested final siRNA concentration was 1.5 μM, followed by 500 nM, going down in eight two-fold serial dilution steps to the lowest final siRNA concentration of 1.95 nM. The experiments ended at 4 h and 72 h post direct incubation of PHH cells. Table 5 lists activity data for all hsHAO1 targeting GalNAc-siRNAs studied. All control siRNAs included in this experiment are summarized and listed in Table 2.
TABLE 5
Target, incubation time, external ID, IC20/IC50/IC80 values
and maximal inhibition of hsHAO1 targeting GalNAc-siRNAs
in primary human hepatocytes (PHHs). The listing is organized
according to external ID, with 4 h and 72 h incubation
listed on top and bottom, respectively.
Incubation External IC20 IC50 IC80 Max.
Target [h] ID [nM] [nM] [nM] Inhib. [%]
hsHAO1 4 ETX001 #N/A #N/A #N/A 3.5
(hsGO1)
hsHAO1 4 ETX003 #N/A #N/A #N/A 8.4
(hsGO1)
hsHAO1 4 ETX005 #N/A #N/A #N/A 0.7
(hsGO1)
hsHAO1 4 ETX007 #N/A #N/A #N/A 0.2
(hsGO1)
hsHAO1 72 ETX001 7.1 514.2 #N/A 54.3
(hsGO1)
hsHAO1 72 ETX003 1.5 53.7 #N/A 49.3
(hsGO1)
hsHAO1 72 ETX005 1.5 127.2 #N/A 53.8
(hsGO1)
hsHAO1 72 ETX007 4.0 #N/A #N/A 38.7
(hsGO1)
Results for the 72 h incubation are also shown in A- 8 D .
Gymnotic, free uptake of GalNAc-siRNAs targeting hsHAO1 did not lead to significant on-target silencing within 4 h, however after 72 h incubation on-target silencing was visible in a range of 35.5 to 58.1% maximal inhibition.
Dose-Response Analysis of hsC5 Targeting GalNAc-siRNAs in PHHs
The second target of interest, hsC5 mRNA, was tested in an identical dose-response setup by gymnotic, free uptake in PHHs with GalNAc-siRNAs sharing identical linker/position/GalNAc-ligand variations as with hsTTR and hsHAO1 tested in the assays before, but sequences specific for the on-target hsC5 mRNA. Sequences for the GalNAc-siRNAs targeting hsC5 and all sequences and information about control siRNAs are listed in Table 1 and Table 2, respectively. The experiment ended after 4 h and 72 h direct incubation of PHHs. Table 6 lists activity data for all hsC5 targeting GalNAc-siRNAs studied.
TABLE 6
Target, incubation time, external ID, IC20/IC50/IC80 values and
maximal inhibition of hsC5 targeting GalNAc-siRNAs in PHHs.
The listing is organized according to external ID, with 4 h
and 72 h incubation listed on top and bottom, respectively.
Incubation External IC20 IC50 IC80 Max.
Target [h] ID [nM] [nM] [nM] Inhib. [%]
C5 4 ETX010 #N/A #N/A #N/A −1.3
C5 4 ETX012 #N/A #N/A #N/A 19.3
C5 4 ETX012 #N/A #N/A #N/A −6.8
(pure FLP
variant)
C5 4 ETX012 #N/A #N/A #N/A 2.6
(pure -
2Da
variant)
C5 4 ETX014 51.8 #N/A #N/A 23.7
C5 4 ETX016 #N/A #N/A #N/A 4.5
C5 72 ETX010 4.3 72.1 #N/A 64.9
C5 72 ETX012 3.9 903.9 #N/A 58.6
C5 72 ETX012 5.3 338.5 #N/A 61.2
(pure FLP
variant)
C5 72 ETX012 2.9 151.0 #N/A 62.5
(pure -
2Da
variant)
C5 72 ETX014 2.2 63.7 #N/A 65.6
C5 72 ETX016 11.4 #N/A #N/A 48.2
Results for the 72 h incubation are also shown in A- 9 D .
No significant on-target silencing of GalNAc-siRNAs is visible after 4 h incubation. Data generated after an incubation period of 72 h showed a more robust on-target silencing of up to 65.5% maximal inhibition.
Dose-Response Analysis of hsTTR Targeting GalNAc-siRNAs in PHHs
The last target of interest, hsTTR mRNA, was again tested in a gymnotic, free uptake in PHHs in an identical dose-response setup as for the targets hsHAO1 and hsC5, with the only difference being that specific siRNA sequences for the on-target hsTTR mRNA was used (see Table 1).
The experiment ended after 72 h of direct incubation of PHHs. Table 7 lists activity data for all hsTTR targeting GalNAc-siRNAs studied.
TABLE 7
Target, incubation time, external ID, IC20/IC50/IC80
values and maximal inhibition of hsTTR targeting
GalNAc-siRNAs in primary human hepatocytes (PHHs).
The listing is organized according to external ID.
Incubation External IC20 IC50 IC80 Max.
Target [h] ID [nM] [nM] [nM] Inhib. [%]
hsTTR 72 ETX019 3.9 29.8 1536.8 82.5
hsTTR 72 ETX021 0.9 16.3 #N/A 72.6
hsTTR 72 ETX023 6.7 377.5 #N/A 54.8
hsTTR 72 ETX025 3.9 #N/A #N/A 46.0
Results are also shown in A- 10 D .
Gymnotic, free uptake of GalNAc-siRNAs targeting hsTTR did lead to significant on-target silencing within 72 h, ranging between 46 to 82.5% maximal inhibition. hsTTR GalNAc-siRNAs were identified that silence the on-target mRNA with IC50 values in the low double-digit nM range.
Conclusions and Discussion
The scope of this study was to analyze the in vitro activity of GalNAc-ligands according to the present invention when used in the context of siRNAs targeting three different on-targets, namely hsHAO1, hsC5 and hsTTR mRNA. siRNA sets specific for each target were composed of siRNAs with different linker/cap/modification/GalNAc-ligand chemistries in the context of two different antisense strands each.
For all targets, GalNAc-siRNAs from Table 1 were identified that showed a high overall potency and low IC50 value.
9.2 Example 2
Routes of Synthesis
i) Synthesis of the conjugate building blocks TriGalNAc
Thin layer chromatography (TLC) was performed on silica-coated aluminium plates with fluorescence indicator 254 nm from Macherey-Nagel. Compounds were visualized under UV light (254 nm), or after spraying with the 5% H 2 SO 4 in methanol (MeOH) or ninhydrin reagent according to Stahl (from Sigma-Aldrich), followed by heating. Flash chromatography was performed with a Biotage Isolera One flash chromatography instrument equipped with a dual variable UV wavelength detector (200-400 nm) using Biotage Sfar Silica 10, 25, 50 or 100 g columns (Uppsala, Sweden).
All moisture-sensitive reactions were carried out under anhydrous conditions using dry glassware, anhydrous solvents and argon atmosphere. All commercially available reagents were purchased from Sigma-Aldrich and solvents from Carl Roth GmbH+Co. KG. D-Galactosamine pentaacetate was purchased from AK scientific.
HPLC/ESI-MS was performed on a Dionex UltiMate 3000 RS UHPLC system and Thermo Scientific MSQ Plus Mass spectrometer using an Acquity UPLC Protein BEH C4 column from Waters (300 Å, 1.7 μm, 2.1×100 mm) at 60° C. The solvent system consisted of solvent A with H 2 O containing 0.1% formic acid and solvent B with acetonitrile (ACN) containing 0.1% formic acid. A gradient from 5-100% of B over 15 min with a flow rate of 0.4 mL/min was employed. Detector and conditions: Corona ultra-charged aerosol detection (from esa). Nebulizer Temp.: 25° C. N 2 pressure: 35.1 psi. Filter: Corona.
1 H and 13 C NMR spectra were recorded at room temperature on a Varian spectrometer at 500 MHz ( 1 H NMR) and 125 MHz ( 13 C NMR). Chemical shifts are given in ppm referenced to the solvent residual peak (CDCl 3 — 1 H NMR: δ at 7.26 ppm and 13 C NMR 6 at 77.2 ppm; DMSO-d 6 - 1 H NMR: δ at 2.50 ppm and 13 C NMR 6 at 39.5 ppm). Coupling constants are given in Hertz. Signal splitting patterns are described as singlet (s), doublet (d), triplet (t) or multiplet (m).
ii) Synthesis route for the conjugate building block TriGalNAc
Preparation of compound 2: D-Galactosamine pentaacetate (3.00 g, 7.71 mmol, 1.0 eq.) was dissolved in anhydrous dichloromethane (DCM) (30 mL) under argon and trimethylsilyl trifluoromethanesulfonate (TMSOTf, 4.28 g, 19.27 mmol, 2.5 eq.) was added. The reaction was stirred at room temperature for 3 h. The reaction mixture was diluted with DCM (50 mL) and washed with cold saturated aq. NaHCO 3 (100 mL) and water (100 mL). The organic layer was separated, dried over Na2SO4 and concentrated to afford the title compound as yellow oil, which was purified by flash chromatography (gradient elution: 0-10% MeOH in DCM in 10 CV). The product was obtained as colourless oil (2.5 g, 98%, rf=0.45 (2% MeOH in DCM)).
Preparation of compound 4: Compound 2 (2.30 g, 6.98 mmol, 1.0 eq.) and azido-PEG3-OH (1.83 g, 10.5 mmol, 1.5 eq.) were dissolved in anhydrous DCM (40 mL) under argon and molecular sieves 3 Å (5 g) was added to the solution. The mixture was stirred at room temperature for 1 h. TMSOTf (0.77 g, 3.49 mmol, 0.5 eq.) was then added to the mixture and the reaction was stirred overnight. The molecular sieves were filtered, the filtrate was diluted with DCM (100 mL) and washed with cold saturated aq. NaHCO 3 (100 mL) and water (100 mL). The organic layer was separated, dried over Na 2 SO 4 and the solvent was removed under reduced pressure. The crude material was purified by flash chromatography (gradient elution: 0-3% MeOH in DCM in 10 CV) to afford the title product as light yellow oil (3.10 g, 88%, rf=0.25 (2% MeOH in DCM)). MS: calculated for C 20 H 32 N 4 O 11 , 504.21. Found 505.4. 1 H NMR (500 MHz, CDCl 3 ) δ 6.21-6.14 (m, 1H), 5.30 (dd, J=3.4, 1.1 Hz, 1H), 5.04 (dd, J=11.2, 3.4 Hz, 1H), 4.76 (d, J=8.6 Hz, 1H), 4.23-4.08 (m, 3H), 3.91-3.80 (m, 3H), 3.74-3.59 (m, 9H), 3.49-3.41 (m, 2H), 2.14 (s, 3H), 2.02 (s, 3H), 1.97 (d, J=4.2 Hz, 6H). 13 C NMR (125 MHz, CDCl 3 ) δ 170.6 (C), 170.5 (C), 170.4 (C), 170.3 (C), 102.1 (CH), 71.6 (CH), 70.8 (CH), 70.6 (CH), 70.5 (CH), 70.3 (CH 2 ), 69.7 (CH 2 ), 68.5 (CH 2 ), 66.6 (CH 2 ), 61.5 (CH 2 ), 23.1 (CH 3 ), 20.7 (3×CH 3 ).
Preparation of compound 5: Compound 4 (1.00 g, 1.98 mmol, 1.0 eq.) was dissolved in a mixture of ethyl acetate (EtOAc) and MeOH (30 mL 1:1 v/v) and Pd/C (100 mg) was added. The reaction mixture was degassed using vacuum/argon cycles (3×) and hydrogenated under balloon pressure overnight. The reaction mixture was filtered through celite and washed with EtOAc (30 mL). The solvent was removed under reduced pressure to afford the title compound as colourless oil (0.95 g, quantitative yield, rf=0.25 (10% MeOH in DCM)). The compound was used without further purification. MS: calculated for C 20 H 34 N 2 O 11 , 478.2. Found 479.4.
Preparation of compound 7: Tris{[2-(tert-butoxycarbonyl)ethoxy]methyl}-methylamine 6 (3.37 g, 6.67 mmol, 1.0 eq.) was dissolved in a mixture of DCM/water (40 mL 1:1 v/v) and Na 2 CO 3 (0.18 g, 1.7 mmol, 0.25 eq.) was added while stirring vigorously. Benzyl chloroformate (2.94 mL, 20.7 mmol, 3.10 eq.) was added dropwise to the previous mixture and the reaction was stirred at room temperature for 24 h. The reaction mixture was diluted with CH 2 Cl 2 (100 mL) and washed with water (100 mL). The organic layer was separated and dried over Na 2 SO 4 . The solvent was removed under reduced pressure and the resulting crude material was purified by flash chromatography (gradient elution: 0-10% EtOAc in cyclohexane in 12 CV) to afford the title compound as pale yellowish oil (3.9 g, 91%, rf=0.56 (10% EtOAc in cyclohexane)). MS: calculated for C 33 H 53 NO 1 , 639.3. Found 640.9. 1 H NMR (500 MHz, DMSO-d 6 ) δ 7.38-7.26 (m, 5H), 4.97 (s, 2H), 3.54 (t, 6H), 3.50 (s, 6H), 2.38 (t, 6H), 1.39 (s, 27H). 13 C NMR (125 MHz, DMSO-d 6 ) δ 170.3 (3×C), 154.5 (C), 137.1 (C), 128.2 (2×CH), 127.7 (CH), 127.6 (2×CH), 79.7 (3×C), 68.4 (3×CH 2 ), 66.8 (3×CH 2 ), 64.9 (C), 58.7 (CH 2 ), 35.8 (3×CH 2 ), 27.7 (9×CH 3 ).
Preparation of compound 8: Cbz-NH-tris-Boc-ester 7 (0.20 g, 0.39 mmol, 1.0 eq.) was dissolved in CH 2 Cl 2 (1 mL) under argon, trifluoroacetic acid (TEA, 1 mL) was added and the reaction was stirred at room temperature for 1 h. The solvent was removed under reduced pressure, the residue was co-evaporated 3 times with toluene (5 mL) and dried under high vacuum to get the compound as its TEA salt (0.183 g, 98%). The compound was used without further purification. MS: calculated for C 21 H 29 NO 11 , 471.6. Found 472.4.
Preparation of compound 9: CbzNH-tris-COOH 8 (0.72 g, 1.49 mmol, 1.0 eq.) and GalNAc-PEG3-NH 2 5 (3.56 g, 7.44 mmol, 5.0 eq.) were dissolved in N,N-dimethylformamide (DMF) (25 mL). Then N,N,N′,N′-tetramethyl-O-(1H-benzotriazol-1-yl)uronium hexafluorophosphate (HBTU) (2.78 g, 7.44 mmol, 5.0 eq.), 1-hydroxybenzotriazole hydrate (HOBt) (1.05 g, 7.44 mmol, 5.0 eq.) and N,N-diisopropylethylamine (DIPEA) (2.07 mL, 11.9 mmol, 8.0 eq.) were added to the solution and the reaction was stirred for 72 h. The solvent was removed under reduced pressure, the residue was dissolved in DCM (100 mL) and washed with saturated aq. NaHCO 3 (100 mL). The organic layer was dried over Na 2 SO 4 , the solvent evaporated and the crude material was purified by flash chromatography (gradient elution: 0-5% MeOH in DCM in 14 CV). The product was obtained as pale yellowish oil (1.2 g, 43%, rf=0.20 (5% MeOH in DCM)). MS: calculated for C 81 H 125 N 7 O 41 , 1852.9. Found 1854.7. 1 H NMR (500 MHz, DMSO-d 6 ) δ 7.90-7.80 (m, 10H), 7.65-7.62 (m, 4H), 7.47-7.43 (m, 3H), 7.38-7.32 (m, 8H), 5.24-5.22 (m, 3H), 5.02-4.97 (m, 4H), 4.60-4.57 (m, 3H), 4.07-3.90 (m 10H), 3.67-3.36 (m, 70H), 3.23-3.07 (m, 25H), 2.18 (s, 10H), 2.00 (s, 13H), 1.89 (s, 11H), 1.80-1.78 (m, 17H). 13 C NMR (125 MHz, DMSO-d 6 ) δ 170.1 (C), 169.8 (C), 169.7 (C), 169.4 (C), 169.2 (C), 169.1 (C), 142.7 (C), 126.3 (CH), 123.9 (CH), 118.7 (CH), 109.7 (CH), 100.8 (CH), 70.5 (CH), 69.8 (CH), 69.6 (CH), 69.5 (CH), 69.3 (CH 2 ), 69.0 (CH 2 ), 68.2 (CH 2 ), 67.2 (CH 2 ), 66.7 (CH 2 ), 61.4 (CH 2 ), 22.6 (CH 2 ), 22.4 (3×CH 3 ), 20.7 (9×CH 3 ).
Preparation of compound 10: Triantennary GalNAc compound 9 (0.27 g, 0.14 mmol, 1.0 eq.) was dissolved in MeOH (15 mL), 3 drops of acetic acid (AcOH) and Pd/C (30 mg) was added. The reaction mixture was degassed using vacuum/argon cycles (3×) and hydrogenated under balloon pressure overnight. The completion of the reaction was followed by mass spectrometry and the resulting mixture was filtered through a thin pad of celite. The solvent was evaporated and the residue obtained was dried under high vacuum and used for the next step without further purification. The product was obtained as pale yellowish oil (0.24 g, quantitative yield). MS: calculated for C 73 H 119 N 7 O 39 , 1718.8. Found 1719.3.
Preparation of compound 11: Commercially available suberic acid bis(N-hydroxysuccinimide ester) (3.67 g, 9.9 mmol, 1.0 eq.) was dissolved in DMF (5 mL) and triethylamine (1.2 mL) was added. To this solution was added dropwise a solution of 3-azido-1-propylamine (1.0 g, 9.9 mmol, 1.0 eq.) in DMF (5 mL). The reaction was stirred at room temperature for 3 h. The reaction mixture was diluted with EtOAc (100 mL) and washed with water (50 mL). The organic layer was separated, dried over Na 2 SO 4 and the solvent was removed under reduced pressure. The crude material was purified by flash chromatography (gradient elution: 0-5% MeOH in DCM in 16 CV). The product was obtained as white solid (1.54 g, 43%, rf=0.71 (5% MeOH in DCM)). MS: calculated for C 15 H 23 N 5 O 5 , 353.4. Found 354.3.
Preparation of TriGalNAc (12): Triantennary GalNAc compound 10 (0.35 g, 0.24 mmol, 1.0 eq.) and compound 11 (0.11 g, 0.31 mmol, 1.5 eq.) were dissolved in DCM (5 mL) under argon and triethylamine (0.1 mL, 0.61 mmol, 3.0 eq.) was added. The reaction was stirred at room temperature overnight. The solvent was removed under reduced pressure, the residue was dissolved in EtOAc (100 mL) and washed with water (100 mL). The organic layer was separated and dried over Na 2 SO 4 . The solvent was evaporated and the resulting crude material was purified by flash chromatography (elution gradient: 0-10% MeOH in DCM in 20 CV) to afford the title compound as white fluffy solid (0.27 g, 67%, rfR=0.5 (10% MeH in DCM)). MS: calculated for C 84 1H 137 N 11 O 41 , 1957.1. Found 1959.6.
Compound 12 was used for subsequent oligonucleotide conjugate preparations employing “click chemistry”.
iii) Oligonucleotide Synthesis
TABLE 8
Single Purity by RP
strand ID Sequence 5′ - 3′ HPLC (%)
X91382 (NH2- 89.5
DEG)gacuuuCfaUfCfCfuggaaauasusa(invabasic)(invabasic)
(SEQ ID NO: 114)
X91383 (NH2- 91.6
DEG)aaGfcAfaGfaUfAfUfuUfuuAfuAfasusa(invabasic)
(invabasic)
(SEQ ID NO: 115)
X91384 (NH2- 94.0
DEG)ugggauUfuCfAfUfguaaccaasgsa(invabasic)(invabasic)
(SEQ ID NO: 116)
X91385 (NH2-DEG)GfaCfuUfuCfaUfcCfuGfgAfaAfuAfsusAf 90.6
(SEQ ID NO: 117)
X91386 (NH2-DEG)AfaGfcAfaGfaUfaUfuUfuUfaUfaAfsusAf 91.2
(SEQ ID NO: 118)
X91387 (NH2-DEG)UfgGfgAfuUfuCfaUfgUfaAfcCfaAfsgsAf 88.7
(SEQ ID NO: 119)
X91403 (NH2C12)gacuuuCfaUfCfCfuggaaauasusa(invabasic) 94.2
(invabasic)
(SEQ ID NO: 120)
X91404 (NH2C12)aaGfcAfaGfaUfAfUfuUfuuAfuAfasusa(invabasic) 96.5
(invabasic)
(SEQ ID NO: 121)
X91405 (NH2C12)ugggauUfuCfAfUfguaaccaasgsa(invabasic) 91.3
(invabasic)
(SEQ ID NO: 122)
X91406 (NH2C12)GfaCfuUfuCfaUfcCfuGfgAfaAfuAfsusAf 95.0
(SEQ ID NO: 123)
X91407 (NH2C12)AfaGfcAfaGfaUfaUfuUfuUfaUfaAfsusAf 97.0
(SEQ ID NO: 124)
X91408 (NH2C12)UfgGfgAfuUfuCfaUfgUfaAfcCfaAfsgsAf 90.0
(SEQ ID NO: 125)
X91415 (invabasic)(invabasic)gsascuuuCfaUfCfCfuggaaauasusa 96.4
(NH2C6)
(SEQ ID NO: 126)
X91416 (invabasic)(invabasic)asasGfcAfaGfaUfAfUfuUfuuAfuAfaua 77.4
(NH2C6)
(SEQ ID NO: 127)
X91417 (invabasic)(invabasic)usgsggauUfuCfAfUfguaaccaaga(NH2C6) 96.7
(SEQ ID NO: 128)
X91418 GfsasCfuUfuCfaUfcCfuGfgAfaAfuAfuAf(NH2C6) 96.0
(SEQ ID NO: 129)
X91419 AfsasGfcAfaGfaUfaUfuUfuUfaUfaAfuAf(NH2C6) 91.8
(SEQ ID NO: 130)
X91420 UfsgsGfgAfuUfuCfaUfgUfaAfcCfaAfgAf(NH2C6) 93.1
(SEQ ID NO: 131)
X91379 gsascuuuCfaUfCfCfuggaaauaua(GalNAc) 92.8
(SEQ ID NO: 132)
X91380 asasGfcAfaGfaUfAfUfuUfuuAfuAfaua(GalNAc) 95.7
(SEQ ID NO: 133)
X91446 usgsggauUfuCfAfUfguaaccaaga(GalNAc) 92.1
(SEQ ID NO: 134)
X38483 usAfsuauUfuCfCfaggaUfgAfaagucscsa 91.0
(SEQ ID NO: 135)
X91381 usAfsUfuAfuaAfaAfauaUfcUfuGfcuususudTdT 90.0
(SEQ ID NO: 136)
X38104 usCfsuugGfuuAfcaugAfaAfucccasusc 95.4
(SEQ ID NO: 137)
X91398 usAfsuAfuUfuCfcAfgGfaUfgAfaAfgUfcsCfsa 90.0
(SEQ ID NO: 138)
X91400 usAfsuUfaUfaAfaAfaUfaUfcUfuGfcUfusUfsudTdT 88.7
(SEQ ID NO: 139)
X91402 usCfsuUfgGfuUfaCfaUfgAfaAfuCfcCfasUfsc 89.6
(SEQ ID NO: 140)
Af, Cf, Gf, Uf: 2′-F RNA nucleotides
a, c, g, u: 2′-O-Me RNA nucleotides
dT: DNA nucleotides
s: Phosphorothioate
invabasic: 1,2-dideoxyribose
NH2-DEG: Aminoethoxyethyl linker
NH2C12: Aminododecyl linker
NH2C6: Aminohexyl linker
Oligonucleotides were synthesized on solid phase according to the phosphoramidite approach. Depending on the scale either a Mermade 12 (BioAutomation Corporation) or an ÄKTA Oligopilot (GE Healthcare) was used.
Syntheses were performed on commercially available solid supports made of controlled pore glass either loaded with invabasic (CPG, 480 Å, with a loading of 86 μmol/g; LGC Biosearch cat. #BCG-1047-B) or 2′-F A (CPG, 520 Å, with a loading of 90 μmol/g; LGC Biosearch cat. #BCG-1039-B) or NH2C6 (CPG, 520 Å, with a loading of 85 μmol/g LGC Biosearch cat. #BCG-1397-B) or GalNAc (CPG, 500 Å, with a loading of 57 μmol/g; Primetech) or 2′-O-Methyl C (CPG, 500 Å, with a loading of 84 μmol/g LGC Biosearch cat. #BCG-10-B) or 2′-O-Methyl A (CPG, 497 Å, with a loading of 85 μmol/g, LGC Biosearch, Cat. #BCG-1029-B) or dT (CPG, 497 Å, with a loading of 87 μmol/g LGC Biosearch, cat. #BCG-1055-B).
2′-O-Me, 2′-F RNA phosphoramidites and ancillary reagents were purchased from SAFC Proligo (Hamburg, Germany).
Specifically, the following 2-O-Methyl phosphoramidites were used: 5′-(4,4′-dimethoxytrityl)-N-benzoyl-adenosine 2′-O-methyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5′-(4,4′-dimethoxytrityl)-N-benzoyl-cytidine 2′-O-methyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5′-(4,4′-dimethoxytrityl)-N-dimethylformamidine-guanosine 2′-O-methyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5′-(4,4′-dimethoxytrityl)-uridine 2′-O-methyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite.
The following 2′-F phosphoramidites were used: 5′-dimethoxytrityl-N-benzoyl-deoxyadenosine 2′-fluoro-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5′-dimethoxytrityl-N-acetyl-deoxycytidine 2′-fluoro-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5′-dimethoxytrityl-N-isobutyryl-deoxyguanosine 2′-fluoro-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite and 5′-dimethoxytrityl-deoxyuridine 2′-fluoro-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite.
In order to introduce the required amino linkers at the 5′-end of the oligonucleotides the 2-[2-(4-Monomethoxytrityl)aminoethoxy]ethyl-(2-cyanoethyl)-N,N-diisopropyl)-phosphoramidite (Glen Research Cat. #1905) and the 12-(trifluoroacetylamino)dodecyl-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (ChemGenes Cat. #CLP-1575) were employed. The invabasic modification was introduced using 5-O-dimethoxytrityl-1,2-dideoxyribose-3-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (ChemGenes Cat. #ANP-1422).
All building blocks were dissolved in anhydrous acetonitrile (100 mM (Mermade12) or 200 mM (ÄKTA Oligopilot)) containing molecular sieves (3 Å) except 2′-O-methyl-uridine phosphoramidite which was dissolved in 50% anhydrous DCM in anhydrous acetonitrile. Iodine (50 mM in pyridine/H 2 O 9:1 v/v) was used as oxidizing reagent. 5-Ethyl thiotetrazole (ETT, 500 mM in acetonitrile) was used as activator solution. Thiolation for introduction of phosphorthioate linkages was carried out using 100 mM xanthane hydride (TCI, Cat. #6846-35-1) in acetonitrile/pyridine 4:6 v/v.
Coupling times were 5.4 minutes except when stated otherwise. 5′ amino modifications were incorporated into the sequence employing a double coupling step with a coupling time of 11 minutes per each coupling (total coupling time 22 min). The oxidizer contact time was set to 1.2 min and thiolation time was 5.2 min.
Sequences were synthesized with removal of the final DMT group, with exception of the MMT group from the NH2DEG sequences.
At the end of the synthesis, the oligonucleotides were cleaved from the solid support using a 1:1 volume solution of 28-30% ammonium hydroxide (Sigma-Aldrich, Cat. #221228) and 40% aqueous methylamine (Sigma-Aldrich, Cat. #8220911000) for 16 hours at 6° C. The solid support was then filtered off, the filter was thoroughly washed with H 2 O and the volume of the combined solution was reduced by evaporation under reduced pressure. The pH of the resulting solution was adjusted to pH 7 with 10% AcOH (Sigma-Aldrich, Cat. #A6283).
The crude materials were purified either by reversed phase (RP) HPLC or anion exchange (AEX) HPLC.
RP HPLC purification was performed using a XBridge C18 Prep 19×50 mm column (Waters) on an ÄKTA Pure instrument (GE Healthcare). Buffer A was 100 mM triethylammonium acetate (TEAAc, Biosolve) pH 7 and buffer B contained 95% acetonitrile in buffer A. A flow rate of 10 mL/min and a temperature of 60° C. were employed. UV traces at 280 nm were recorded. A gradient of 0% B to 100% B within 120 column volumes was employed. Appropriate fractions were pooled and precipitated in the freezer with 3 M sodium acetate (NaOAc) (Sigma-Aldrich), pH 5.2 and 85% ethanol (VWR). Pellets were isolated by centrifugation, redissolved in water (50 mL), treated with 5 M NaCl (5 mL) and desalted by Size exclusion HPLC on an Akta Pure instrument using a 50×165 mm ECO column (YMC, Dinslaken, Germany) filled with Sephadex G25-Fine resin (GE Healthcare).
AEX HPLC purification was performed using a TSK gel SuperQ-5PW 20×200 mm (BISCHOFF Chromatography) on an ÄKTA Pure instrument (GE Healthcare). Buffer A was 20 mM sodium phosphate (Sigma-Aldrich) pH 7.8 and buffer B was the same as buffer A with the addition of 1.4 M sodium bromide (Sigma-Aldrich). A flow rate of 10 mL/min and a temperature of 60° C. were employed. UV traces at 280 nm were recorded. A gradient of 10% B to 100% B within 27 column volumes was employed. Appropriate fractions were pooled and precipitated in the freezer with 3 M NaOAc, pH 5.2 and 85% ethanol. Pellets were isolated by centrifugation, redissolved in water (50 mL), treated with 5 M NaCl (5 mL) and desalted by size exclusion chromatography.
The MMT group was removed with 25% acetic acid in water. Once the reaction was complete the solution was neutralized and the samples were desalted by size exclusion chromatography.
Single strands were analyzed by analytical LC-MS on a 2.1×50 mm XBridge C18 column (Waters) on a Dionex Ultimate 3000 (Thermo Fisher Scientific) HPLC system combined either with a LCQ Deca XP-plus Q-ESI-TOF mass spectrometer (Thermo Finnigan) or with a Compact ESI-Qq-TOF mass spectrometer (Bruker Daltonics). Buffer A was 16.3 mM triethylamine, 100 mM 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP) and 1% MeOH in H 2 O and buffer B contained buffer A in 95% MeOH. A flow rate of 250 μL/min and a temperature of 60° C. were employed. UV traces at 260 and 280 nm were recorded. A gradient of 1-40% B within 0.5 min followed by 40 to 100% B within 13 min was employed. Methanol (LC-MS grade), water (LC-MS grade), 1,1,1,3,3,3-hexafluoro-2-propanol (puriss. p.a.) and triethylamine (puriss. p.a.) were purchased from Sigma-Aldrich.
iv) Monofluoro cyclooctyne (MFCO) conjugation at 5′- or 3′-end
5′-end MFCO conjugation
3′-end MFCO conjugation
General conditions for MFCO conjugation: Amine-modified single strand was dissolved at 700 OD/mL in 50 mM carbonate/bicarbonate buffer pH 9.6/dimethyl sulfoxide (DMSO) 4:6 (v/v) and to this solution was added one molar equivalent of a 35 mM solution of MFCO-C6-NHS ester (Berry&Associates, Cat. #LK 4300) in DMF. The reaction was carried out at room temperature and after 1 h another molar equivalent of the MFCO solution was added. The reaction was allowed to proceed for an additional hour and was monitored by LC/MS. At least two molar equivalent excess of the MFCO NHS ester reagent relative to the amino modified oligonucleotide were needed to achieve quantitative consumption of the starting material. The reaction mixture was diluted 15-fold with water, filtered through a 1.2 μm filter from Sartorius and then purified by reserve phase (RP HPLC) on an Akta Pure instrument (GE Healthcare).
Purification was performed using a XBridge C18 Prep 19×50 mm column from Waters. Buffer A was 100 mM TEAAc pH 7 and buffer B contained 95% acetonitrile in buffer A. A flow rate of 10 mL/min and a temperature of 60° C. were employed. UV traces at 280 nm were recorded. A gradient of 0-100% B within 60 column volumes was employed.
Fractions containing full length conjugated oligonucleotide were pooled, precipitated in the freezer with 3 M NaOAc, pH 5.2 and 85% ethanol and the collected pellet was dissolved in water. Samples were desalted by size exclusion chromatography and concentrated using a speed-vac concentrator to yield the conjugated oligonucleotide in an isolated yield of 40-80%.
TABLE 9
Sense Purity by RP
strand ID Sense strand sequence 5′ - 3′ HPLC (%)
X91388 (MFCO)(NH- 89.0
DEG)gacuuuCfaUfCfCfuggaaauasusa(invabasic)(invabasic)
(SEQ ID NO: 58)
X91389 (MFCO)(NH- 91.0
DEG)aaGfcAfaGfaUfAfUfuUfuuAfuAfasusa(invabasic)
(invabasic)
(SEQ ID NO: 59)
X91390 (MFCO)(NH- 90.0
DEG)ugggauUfuCfAfUfguaaccaasgsa(invabasic)(invabasic)
(SEQ ID NO: 60)
X91391 (MFCO)(NH-DEG)GfaCfuUfuCfaUfcCfuGfgAfaAfuAfsusAf 86.0
(SEQ ID NO: 177)
X91392 (MFCO)(NH-DEG)AfaGfcAfaGfaUfaUfuUfuUfaUfaAfsusAf 87.0
(SEQ ID NO: 178)
X91393 (MFCO)(NH-DEG)UfgGfgAfuUfuCfaUfgUfaAfcCfaAfsgsAf 86.0
(SEQ ID NO: 179)
X91421 (invabasic)(invabasic)gsascuuuCfaUfCfCfuggaaauasusa(NHC6) 94.0
(MFCO)
(SEQ ID NO: 61)
X91422 (invabasic)(invabasic)asasGfcAfaGfaUfAfUfuUfuuAfuAfaua 89.0
(NHC6)(MFCO)
(SEQ ID NO: 62)
X91423 (invabasic)(invabasic)usgsggauUfuCfAfUfguaaccaaga(NHC6) 89.0
(MFCO)
(SEQ ID NO: 63)
X91424 GfsasCfuUfuCfaUfcCfuGfgAfaAfuAfuAf(NHC6)(MFCO) 90.0
(SEQ ID NO: 180)
X91425 AfsasGfcAfaGfaUfaUfuUfuUfaUfaAfuAf(NHC6)(MFCO) 89.0
(SEQ ID NO: 181)
X91426 UfsgsGfgAfuUfuCfaUfgUfaAfcCfaAfgAf(NHC6)(MFCO) 89.0
(SEQ ID NO: 182)
v) TriGalNAc (GalNAc-T1) conjugation at 5′- or 3′-end 5′-Ga1NAc-T1 conjugates
3′-GalNAc-T1 conjugates
General procedure for TriGalNAc conjugation: MFCO-modified single strand was dissolved at 2000 OD/mL in water and to this solution was added one equivalent solution of compound 12 (10 mM) in DMF. The reaction was carried out at room temperature and after 3 h 0.7 molar equivalent of the compound 12 solution was added. The reaction was allowed to proceed overnight and completion was monitored by LCMS. The conjugate was diluted 15-fold in water, filtered through a 1.2 μm filter from Sartorius and then purified by RP HPLC on an Akta Pure instrument (GE Healthcare).
RP HPLC purification was performed using a XBridge C18 Prep 19×50 mm column from Waters. Buffer A was 100 mM triethylammonium acetate pH 7 and buffer B contained 95% acetonitrile in buffer A. A flow rate of 10 mL/min and a temperature of 60° C. were employed. UV traces at 280 nm were recorded. A gradient of 0-100% B within 60 column volumes was employed.
Fractions containing full-length conjugated oligonucleotide were pooled, precipitated in the freezer with 3 M NaOAc, pH 5.2 and 85% ethanol and the collected pellet was dissolved in water to give an oligonucleotide solution of about 1000 OD/mL. The O-acetates were removed by adding 20% aqueous ammonia. Quantitative removal of these protecting groups was verified by LC-MS.
The conjugates were desalted by size exclusion chromatography using Sephadex G25 Fine resin (GE Healthcare) on an Akta Pure (GE Healthcare) instrument to yield the conjugated nucleotide in an isolated yield of 50-70%.
TABLE 10
Purity by
Sense RP HPLC
strand ID Sense strand sequence 5′ - 3′ (%)
X91394 (GalNAc-T1)(MFCO)(NH- 80.0
DEG)gacuuuCfaUfCfCfuggaaauasusa(invabasic)(invabasic)
(SEQ ID NO: 64)
X91395 (GalNAc-T1)(MFCO)(NH- 87.8
DEG)aaGfcAfaGfaUfAfUfuUfuuAfuAfasusa(invabasic)(invabasic)
(SEQ ID NO: 65)
X91396 (GalNAc-T1)(MFCO)(NH- 87.9
DEG)ugggauUfuCfAfUfguaaccaasgsa(invabasic)(invabasic)
(SEQ ID NO: 66)
X91397 (GalNAc-T1)(MFCO)(NH- 83.0
DEG)GfaCfuUfuCfaUfcCfuGfgAfaAfuAfsusAf
(SEQ ID NO: 13)
X91399 (GalNAc-T1)(MFCO)(NH- 80.5
DEG) AfaGfcAfaGfaUfaUfuUfuUfaUfaAfsusAf
(SEQ ID NO: 15)
X91401 (GalNAc-T1)(MFCO)(NH- 81.7
DEG)UfgGfgAfuUfuCfaUfgUfaAfcCfaAfsgsAf
(SEQ ID NO: 17)
X91427 (invabasic)(invabasic)gsascuuuCfaUfCfCfuggaaauasusa(NHC6) 88.0
(MFCO)(GalNAc-T1)
(SEQ ID NO: 67)
X91428 (invabasic)(invabasic)asasGfcAfaGfaUfAfUfuUfuuAfuAfaua(NHC6) 82.6
(MFCO)(GalNAc-T1)
(SEQ ID NO: 68)
X91429 (invabasic)(invabasic)usgsggauUfuCfAfUfguaaccaaga(NHC6) 82.9
(MFCO)(GalNAc-T1)
(SEQ ID NO: 69)
X91430 GfsasCfuUfuCfaUfcCfuGfgAfaAfuAfuAf(NHC6)(MFCO)(GalNAc- 83.0
T1)
(SEQ ID NO: 19)
X91431 AfsasGfcAfaGfaUfaUfuUfuUfaUfaAfuAf(NHC6)(MFCO)(GalNAc- 82.6
T1)
(SEQ ID NO: 21)
X91432 UfsgsGfgAfuUfuCfaUfgUfaAfcCfaAfgAf(NHC6)(MFCO)(GalNAc- 81.2
T1)
(SEQ ID NO: 23)
vi) Duplex Annealing
To generate the desired siRNA duplex, the two complementary strands were annealed by combining equimolar aqueous solutions of both strands. The mixtures were placed into a water bath at 70° C. for 5 minutes and subsequently allowed to cool to ambient temperature within 2 h. The duplexes were lyophilized for 2 days and stored at −20° C.
The duplexes were analyzed by analytical SEC HPLC on Superdex™ 75 Increase 5/150 GL column 5×153-158 mm (Cytiva) on a Dionex Ultimate 3000 (Thermo Fisher Scientific) HPLC system. Mobile phase consisted of 1× PBS containing 10% acetonitrile. An isocratic gradient was run in 10 min at a flow rate of 1.5 mL/min at room temperature. UV traces at 260 and 280 nm were recorded. Water (LC-MS grade) was purchased from Sigma-Aldrich and Phosphate-buffered saline (PBS; 10×, pH 7.4) was purchased from GIBCO (Thermo Fisher Scientific).
GalNAc conjugates prepared are compiled in the table below. These were directed against 3 different target genes. siRNA coding along with the corresponding single strands, sequence information as well as purity for the duplexes is captured.
TABLE 11
Duplex
Purity
by
Duplex SSRN HPLC
Target ID ID ssRNA-Sequence 5′-3′ (%)
GO ETX001 X91394 (GalNAc- 96.8
T1)(MFCO)(NHDEG)gacuuuCfaUfCfCfuggaaauasusa(invabasic)
(invabasic)
(SEQ ID NO: 1)
X38483 usAfsuauUfuCfCfaggaUfgAfaagucscsa
(SEQ ID NO: 2)
ETX003 X91397 (GalNAc-T1)(MFCO)(NH- 97.6
DEG)GfaCfuUfuCfaUfcCfuGfgAfaAfuAfsusAf
(SEQ ID NO: 13)
X91398 usAfsuAfuUfuCfcAfgGfaUfgAfaAfgUfcsCfsa
(SEQ ID NO: 14)
ETX005 X91427 (invabasic)(invabasic)gsascuuuCfaUfCfCfuggaaauasusa 92.8
(NHC6)(MFCO)(GalNAc-T1)
(SEQ ID NO: 7)
X38483 usAfsuauUfuCfCfaggaUfgAfaagucscsa
(SEQ ID NO: 8)
ETX007 X91430 GfsasCfuUfuCfaUfcCfuGfgAfaAfuAfuAf(NHC6)(MFCO) 96.8
(GalNAc-T1)
(SEQ ID NO: 19)
X91398 usAfsuAfuUfuCfcAfgGfaUfgAfaAfgUfcsCfsa
(SEQ ID NO: 20)
C5 ETX010 X91395 (GalNAc-T1)(MFCO)(NH- 96.4
DEG)aaGfcAfaGfaUfAfUfuUfuuAfuAfasusa(invabasic)
(invabasic)
(SEQ ID NO: 3)
X91381 usAfsUfuAfuaAfaAfauaUfcUfuGfcuususudTdT
(SEQ ID NO: 4)
ETX012 X91399 (GalNAc-T1)(MFCO)(NH- 97.1
DEG)AfaGfcAfaGfaUfaUfuUfuUfaUfaAfsusAf
(SEQ ID NO: 15)
X91400 usAfsuUfaUfaAfaAfaUfaUfcUfuGfcUfusUfsudTdT
(SEQ ID NO: 16)
ETX014 X91428 (invabasic)(invabasic)asasGfcAfaGfaUfAfUfuUfuuAfuAfaua 97.2
(NHC6)(MFCO)(GalNAc-T1)
(SEQ ID NO: 9)
X91381 usAfsUfuAfuaAfaAfauaUfcUfuGfcuususudTdT
(SEQ ID NO: 10)
ETX016 X91431 AfsasGfcAfaGfaUfaUfuUfuUfaUfaAfuAf(NHC6)(MFCO) 96.8
(GalNAc-T1)
(SEQ ID NO: 21)
X91400 usAfsuUfaUfaAfaAfaUfaUfcUfuGfcUfusUfsudTdT
(SEQ ID NO: 22)
TTR ETX019 X91396 (GalNAc-T1)(MFCO)(NH- 97.2
DEG)ugggauUfuCfAfUfguaaccaasgsa(invabasic)(invabasic)
(SEQ ID NO: 5)
X38104 usCfsuugGfuuAfcaugAfaAfucccasusc
(SEQ ID NO: 6)
ETX021 X91401 (GalNAc-T1)(MFCO)(NH- 95.5
DEG)UfgGfgAfuUfuCfaUfgUfaAfcCfaAfsgsAf
(SEQ ID NO: 17)
X91402 usCfsuUfgGfuUfaCfaUfgAfaAfuCfcCfasUfsc
(SEQ ID NO: 18)
ETX023 X91429 (invabasic)(invabasic)usgsggauUfuCfAfUfguaaccaaga(NHC6) 96.3
(MFCO)(GalNAc-T1)
(SEQ ID NO: 11)
X38104 usCfsuugGfuuAfcaugAfaAfucccasusc
(SEQ ID NO: 12)
ETX025 X91432 UfsgsGfgAfuUfuCfaUfgUfaAfcCfaAfgAf(NHC6)(MFCO)(Gal 97.5
NAc-T1)
(SEQ ID NO: 23)
X91402 usCfsuUfgGfuUfaCfaUfgAfaAfuCfcCfasUfsc
(SEQ ID NO: 24)
The following schemes further set out the routes of synthesis:
Example 3
Mouse Data for GalNAc-siRNA Constructs ETX005 and ETX014
ETX005 (Targeting HAO1 mRNA) T1a Inverted Abasic
An in vivo mouse pharmacology study was performed showing knockdown of HAO1 mRNA in liver tissue with an associated increase in serum glycolate level following a single subcutaneous dose of up to 3 mg/kg GalNAc conjugated modified siRNA ETX005.
Male C57BL/6 mice with an age of about 8 weeks were randomly assigned into groups of 21 mice. On day 0 of the study, the animals received a single subcutaneous dose of 0.3 or 3 mg/kg GalNAc-siRNA dissolved in saline (sterile 0.9% sodium chloride) or saline only as control. At day 1, day 2, day 4, day 7, day 14, day 21, and day 28 of the study, 3 mice from each group were euthanised and serum and liver samples taken.
Serum was taken from a group of 5 untreated mice at day 0 to provide a baseline measurement of glycolate concentration.
Serum was stored at −80° C. until further analysis. Liver sample (approximately 50 mg) were treated with RNAlater and stored overnight at 4° C., before being stored at −80° C.
Liver samples were analysed using quantitative real-time PCR for HAO1 mRNA (Thermo assay ID Mm00439249_ml) and the housekeeping gene GAPDH mRNA (Thermo assay ID Mm99999915_g1). The delta delta Ct method was used to calculated changes in HAO1 expression normalised to GAPDH and relative to the saline control group.
A single 3 mg/kg dose of ETX005 inhibited HAG1 mRNA expression by greater than 80% after 7 days ( ). The suppression of HAO1 expression was durable, with a single 3 mg/kg dose of ETX005 maintaining greater than 60% inhibition of HAO1 mRNA at the end of the study on day 28. A single dose of 0.3 mg/kg ETX005 also inhibited HAG1 expression when compared with the saline control group, with HAG1 expression levels reaching normal levels only at day 28 of the study.
Suppression of HAG1 mRNA expression is expected to cause an increase in serum glycolate levels. Serum glycolate concentration was measured using LC-MS/MS ( ). A single 3 mg/kg dose of ETX005 caused a significant increase in serum glycolate concentration, reaching peak levels 14 days after dosing and remaining higher than baseline level (day 0) and the saline control group until the end of the study at day 28. A single 0.3 mg/kg dose of ETX005 showed a smaller and more transient increase in serum glycolate concentration above the level seen in a baseline and saline control group, demonstrating that a very small dose can suppress HAG1 mRNA at a magnitude sufficient to affect the concentration of a metabolic biomarker in serum.
ETX014 (Targeting C5 mRNA) T1a Inverted Abasic
An in vivo mouse pharmacology study was performed showing knockdown of C5 mRNA in liver tissue and the resulting decrease in serum C5 protein concentration following a single subcutaneous dose of up to 3 mg/kg GalNAc conjugated modified siRNA ETX014.
Male C57BL/6 mice with an age of about 8 weeks were randomly assigned into groups of 21 mice. On day 0 of the study, the animals received a single subcutaneous dose of 0.3, 1, or 3 mg/kg GalNAc-siRNA dissolved in saline (sterile 0.9% sodium chloride) or saline only as control. At day 1, day 2, day 4, day 7, day 14, day 21, and day 28 of the study, 3 mice from each group were euthanised and serum and liver samples taken.
Serum was stored at −80° C. until further analysis. Liver sample (approximately 50 mg) were treated with RNAlater and stored overnight at 4° C., before being stored at −80° C.
Liver samples were analysed using quantitative real-time PCR for C5 mRNA (Thermo assay ID Mm00439275_ml) and the housekeeping gene GAPDH mRNA (Thermo assay ID Mm99999915_g1). The delta delta Ct method was used to calculated changes in C5 expression normalised to GAPDH and relative to the saline control group.
ETX014 inhibited C5 mRNA expression in a dose-dependent manner ( ) with the 3 mg/kg dose achieving greater than 90% reduction in C5 mRNA at day 14. The suppression of C5 expression by ETX014 was durable, with the 3 mg/kg dose of each molecule showing clear knockdown of C5 mRNA until the end of the study at day 28.
For C5 protein level analysis, serum samples were measured using a commercially available C5 ELISA kit (Abcam ab264609). Serum C5 levels were calculated relative to the saline group means at matching timepoints.
Serum protein data support the mRNA analysis ( ). Treatment with ETX014 caused a dose-dependent decrease in serum C5 protein concentration. All doses of ETX014 reduced C5 protein levels by greater than 70%, with the 3 mg/kg dose reducing C5 levels to almost undetectable levels at day 7 of the study. Reduction of serum C5 was sustained by all doses until study termination, with even the lowest dose of 0.3 mg/kg still showing inhibition of approximately 40% at day 28.
Example 4 NHP Data for GalNAc-siRNA Construct ETX023
ETX023 (Targeting TTR mRNA) T1a Inverted Abasic
ETX023 pharmacology was evaluated in non-human primate (NHP) by quantifying serum transthyretin (TTR) protein levels. A single subcutaneous dose of 1 mg/kg GalNAc conjugated modified siRNA ETX023 demonstrated durable suppression of TTR protein expression.
Male cynomolgus monkeys (3-5 years old, 2-3 kg) were assigned into groups of 3 animals. Animals were acclimatised for 2 weeks, and blood taken 14 days prior to dosing to provide baseline TTR concentration. A liver biopsy was performed 18 or 38 days prior to dosing to provide baseline mRNA levels. On day 0 of the study, the animals received a single subcutaneous dose of 1 mg/kg GalNAc-siRNA ETX023 dissolved in saline (sterile 0.9% sodium chloride). At day 3, day 14, day 28, day 42, day 56, day 70 and day 84 of the study, a liver biopsy was taken and RNA extracted for measurement of TTR mRNA. At day 1, day 3, day 7, day 14, day 28, day 42, day 56, 70 and day 84 of the study, a blood sample was taken for measurement of serum TTR concentration and clinical blood chemistry analysis.
Suppression of TTR mRNA expression is expected to cause a decrease in serum TTR protein levels. Serum TTR protein concentration was measured by a commercially available ELISA kit (Abcam ab231920). TTR concentration as a fraction of day 1 was calculated for each individual animal and this was plotted as mean and standard deviation for the group of 3 animals ( ).
A single 1 mg/kg dose of ETX023 caused a rapid and significant reduction in serum TTR concentration, reaching nadir 28 days after dosing and remaining suppressed until day 70.
Data was further obtained until day 84. Identical experiments were carried out using ETX019, 021, 025. Data is provided for 84 days in , 17 , 18 A and 19 (ETX019, 021, 023 and 025 respectively).
TTR mRNA was measured by real-time quantitative PCR using a TaqMan Gene expression kit TTR (Thermo, assay ID Mf02799963_ml). GAPDH expression was also measured (Thermo, assay ID Mf04392546_g1) to provide a reference. Relative TTR expression for each animal was calculated normalised to GAPDH and relative to pre-dose levels by the DDCt method. A single 1 mg/kg dose of ETX023 also caused a rapid and significant reduction in liver TTR mRNA, reaching nadir 14 days after dosing and remaining suppressed until day 84 ( B ).
Animal body weight was measured once a week during the study. No fluctuations or decrease in body weight was associated with dosing ETX023 and animals continued to gain weight throughout the study ( C ).
Serum was analysed within 2 hours using an automatic biochemical analyser. A significant increase in ALT (alanine transaminase) and AST (aspartate transaminase) are commonly used to demonstrate liver toxicity. No increase in ALT ( D ) or ALT ( E ) was associated with dosing of ETX023.
In preferred aspects, compounds of the invention are able to depress serum protein level of a target protein to a value below the initial (starting) concentration at day 0, over a period of up to at least about 14 days after day 0, up to at least about 21 days after day 0, up to at least about 28 days after day 0, up to at least about 35 days after day 0, up to at least about 42 days after day 0, up to at least about 49 days after day 0, up to at least about 56 days after day 0, up to at least about 63 days after day 0, up to at least about 70 days after day 0, up to at least about 77 days after day 0, or up to at least about 84 days after day 0, hereinafter referred to as the “dose duration”. “Day 0” as referred to herein is the day when dosing of a compound of the invention to a patient is initiated, in other words the start of the dose duration or the time post dose.
In preferred aspects, compounds of the invention are able to depress serum protein level of a target protein to a value of at least about 90% or below of the initial (starting) concentration at day 0, such as at least about 85% or below, at least about 80% or below, at least about 75% or below, at least about 70% or below, at least about 65% or below, at least about 60% or below, at least about 55% or below, at least about 50% or below, at least about 45% or below, at least about 40% or below, at least about 35% or below, at least about 30% or below, at least about 25% or below, at least about 20% or below, at least about 15% or below, at least about 10% or below, at least about 5% or below, of the initial (starting) concentration at day 0. Typically such depression of serum protein can be maintained over a period of up to at least about 14 days after day 0, up to at least about 21 days after day 0, up to at least about 28 days after day 0, up to at least about 35 days after day 0, up to at least about 42 days after day 0, up to at least about 49 days after day 0, up to at least about 56 days after day 0, up to at least about 63 days after day 0, up to at least about 70 days after day 0, up to at least about 77 days after day 0, or up to at least about 84 days after day 0. More preferably, at a period of up to at least about 84 days after day 0, the serum protein can be depressed to a value of at least about 90% or below of the initial (starting) concentration at day 0, such as at least about 85% or below, at least about 80% or below, at least about 75% or below, at least about 70% or below, at least about 65% or below, at least about 60% or below, at least about 55% or below, at least about 50% or below, at least about 45% or below, at least about 40% or below, of the initial (starting) concentration at day 0.
In preferred aspects, compounds of the invention are able to achieve a maximum depression of serum protein level of a target protein to a value of at least about 50% or below of the initial (starting) concentration at day 0, such as at least about 45% or below, at least about 40% or below, at least about 35% or below, at least about 30% or below, at least about 25% or below, at least about 20% or below, at least about 15% or below, at least about 10% or below, at least about 5% or below, of the initial (starting) concentration at day 0. Typically such maximum depression of serum protein occurs at about day 14 after day 0, at about day 21 after day 0, at about day 28 after day 0, at about day 35 after day 0, or at about day 42 after day 0. More typically, such maximum depression of serum protein occurs at about day 14 after day 0, at about day 21 after day 0, or at about day 28 after day 0.
Specific compounds of the invention can typically achieve a maximum % depression of serum protein level of a target protein and/or a % depression over a period of up to at least about 84 days as follows:
•
• ETX019 can typically achieve at least 50% depression of serum protein level of a target protein, typically TTR, typically at about 7 to 21 days after day 0, in particular at about 14 days after day 0, and/or can typically maintain at least 90% depression of serum protein level of a target protein, typically TTR, over a period of up to at least about 84 days after day 0 (as hereinbefore described, “day 0” as referred to herein is the day when dosing of a compound of the invention to a patient is initiated, and as such denotes the time post dose); • ETX021 can typically achieve at least 40% depression of serum protein level of a target protein, typically TTR, typically at about 7 to 21 days after day 0, in particular at about 14 days after day 0, and/or can typically maintain at least 80% depression of serum protein level of a target protein, typically TTR, over a period of up to at least about 84 days after day 0 (as hereinbefore described, “day 0” as referred to herein is the day when dosing of a compound of the invention to a patient is initiated, and as such denotes the time post dose); • ETX023 can typically achieve at least 20% depression of serum protein level of a target protein, typically TTR, typically at about 7 to 21 days after day 0, in particular at about 14 days after day 0, and/or can typically maintain at least 50% depression of serum protein level of a target protein, typically TTR, over a period of up to at least about 84 days after day 0 (as hereinbefore described, “day 0” as referred to herein is the day when dosing of a compound of the invention to a patient is initiated, and as such denotes the time post dose); • ETX025 can typically achieve at least 50% depression of serum protein level of a target protein, typically TTR, typically at about 7 to 21 days after day 0, in particular at about 14 days after day 0, and/or can typically maintain at least 70% depression of serum protein level of a target protein, typically TTR, over a period of up to at least about 84 days after day 0 (as hereinbefore described, “day 0” as referred to herein is the day when dosing of a compound of the invention to a patient is initiated, and as such denotes the time post dose). Suitably the depression of serum level is determined in non-human primates by delivering a single subcutaneous dose of 1 mg/kg of the relevant active agent, eg ETX0023, dissolved in saline (sterile 0.9% sodium chloride). Suitable methods are described herein. It will be appreciated that this is not limiting and other suitable methods with appropriate controls may be used.
Example 5 ETX023 (Targeting TTR mRNA) T1a Inverted Abasic
Total Bilirubin Levels Remained Stable Throughout the Study (FIG. 22 )
Kidney health was monitored by assessment of urea (blood urea nitrogen, BUN) and creatinine concentration throughout the study. Both blood urea concertation (BUN) and creatinine levels remained stable and within the expected range after a single 1 mg/kg dose of ETX023 ( ).
The present invention is not intended to be limited in scope to the particular disclosed embodiments, which are provided, for example, to illustrate various aspects of the invention. Various modifications to the compositions and methods described will become apparent from the DESCRIPTION and teachings herein. Such variations may be practiced without departing from the true scope and spirit of the disclosure and are intended to fall within the scope of the present disclosure.
A further aspect of the invention is described below, with non-limiting examples described in the following and Examples 6-15. The compounds described below are suitable for use in any of the aspects and embodiments disclosed above, for example in respect of the uses, nucleic acid lengths, definitions, pharmaceutically acceptable compositions, dosing, methods for inhibiting gene expression, and methods of treating or preventing diseases associated with gene expression, unless otherwise immediately apparent from the disclosure.
A depicts a tri-antennary GalNAc (N-acetylgalactosamine) unit
B depicts an alternative tri-antennary GalNAc according to one embodiment of the invention, showing variance in linking groups.
A depicts tri-antennary GalNAc-conjugated siRNA according to the invention, showing variance in the linking groups.
B depicts a genera of tri-antennary GalNAc-conjugated siRNAs according to one embodiment of the invention.
C depicts a genera of bi-antennary GalNAc-conjugated siRNAs according to one embodiment of the invention, showing variance in the linking groups.
D depicts a genera of bi-antennary GalNAc-conjugated siRNAs according to another embodiment of the invention, showing variance in the linking groups.
A depicts another embodiment of the tri-antennary GalNAc-conjugated siRNA according to one embodiment of the invention.
B depicts a variant shown in A , having an alternative branching GalNAc conjugate.
C depicts a genera of tri-antennary GalNAc-conjugated siRNAs according to one embodiment of the invention, showing variance in the linking groups.
D depicts a genera of bi-antennary GalNAc-conjugated siRNAs according to one embodiment the invention, showing variance in the linking groups.
The further aspect discloses forms of ASGP-R ligand-conjugated, chemically modified RNAi agents, and methods of making and uses of such conjugated molecules.
In certain embodiments, the ASGP-R ligand comprises N-acetylgalactosamine (GalNAc). In certain embodiments, the invention provides an siRNA conjugated to tri-antennary or biantennary units of GalNAc of the following formula (I):
In Formula I*, n is 0, 1, 2, 3, or 4. In some embodiments, the number of the ethylene-glycol units may vary independently from each other in the different branches. For example, the middle branch may have n=4, while the side branches may have n=3, etc. Other embodiments my contain only two branches, as depicted in Formulae (II-a)
In Formulae II* and II*-a, n is chosen from 0, 1, 2, 3, or 4. In some embodiments, the number of the ethylene-glycol units may vary independently from each other in the different branches. For example, the one branch may have n=4 or 3, while the other branche(s) may have n=3 or 2, etc.
Additional GalNAc branches can also be added, for example, 4-, 5-, 6-, 7-, 8-, 9-branched GalNAc units may be used.
In related embodiments, the branched GalNAc can be chemically modified by the addition of another targeting moiety, e.g., a lipids, cholesterol, a steroid, a bile acid, targeting (poly)peptide, including polypeptides and proteins, (e.g., RGD peptide, transferrin, polyglutamate, polyaspartate, glycosylated peptide, biotin, asialoglycoprotein insulin and EGF.
Option 1. In further embodiments, the GaINAc units may be attached to the RNAi agent via a tether, such as the one shown in Formula (III*):
In Formula III*, m is chosen from 0, 1, 2, 3, 4, or 5, and p is chosen from 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14, independently of m, and X is either CH 2 or O.
In yet further embodiments, the tether can attach to the oligo via phosphate (Z═O) or a phosphorothioate group (Z═S), as shown in formula (IV*):
Such an attachment of the GalNAc branched units via the specified tethers is preferably at a 3′ or a 5′ end of the sense strand of the RNAi agent. In one embodiment, the attachment to the 3′ of RNAi agent is through C6 amino linker as shown in Formula (V*):
This linker is the starting point of the synthesis as shown in Example 12.
The same linkers and tethers as described above can be used with alternative branched GalNAc structures as shown in Formulas VI* and VII*:
Similarly to Formula II*-a, a bi-antennary form of ligand based on Formulae VI* and VII* can be used in the compositions of the invention.
Option 2. In further embodiments, the GalNAc units may be attached to the RNAi agent via a tether, such as the one shown in Formula (III*-2):
In Formula II*-2. q is chosen from 1, 2, 3, 4, 5, 6, 7 or 8,
In yet further embodiments, the tether can attach to the oligo via phosphate (Z═O) or a phosphorothioate group (Z═S), as shown in formula (WV*):
Such an attachment of the GalNAc branched units via the specified tethers preferably at a 3′ or a 5′ end of the sense strand of the double stranded RNAi agent. In one embodiment, the attachment to the 3′ of RNAi agent is as shown in Example 14. In one embodiment when the GalNAc tether is at attached to the 3′ site, the transitional linker between the tether and the 3′ end of the oligo comprises the structure of the formula (V*-a; see also C ) or another suitable linker may be used, for example, C6 amino linker shown in Formula (V*-b):
Additional and/or alternative conjugation sites may include any non-terminal nucleotide, including sugar residues, phosphate groups, or nucleic acid bases.
The same linkers and tether can be used with alternative branched GalNAc structures as shown in Formulas VI*-2 and VII*-2:
Characteristics of RNAi Agents of the Invention and their Chemical Modifications
In certain embodiments, the conjugated oligomeric compound (referred herein as RNA interference compound (RNAi compound)) comprises two strands, each having sequence of from 8 to 55 linked nucleotide monomer subunits (including inverted abasic (ia) nucleotide(s)) in either the antisense strand or in the sense strand. In certain embodiments, the conjugated oligomeric compound strands comprise, for example, a sequence of 16 to 55, 53, 49, 40, 25, 24, 23, 21, 20, 19, 18, 17, or up to (about) 18-25, 18-23, 21-23 linked nucleotide monomer subunits. In certain embodiments, RNAi agent of the invention may have a hairpin structure, having a single strand of the combined lengths of both strands as described above. (The term “nucleotide” as used throughout, may also refer to nucleosides (i.e., nucleotides without phosphate/phosphonothioate groups) where context so requires.)
In certain embodiments, the double stranded RNAi agent is blunt-ended or has an overhang at one or both ends. In some embodiments, the overhang is 1-6, 1-5, 1-4, 1-3, 2-4, 4, 3, 2 or 1 nucleotide(s) (at 3′ end or at 5′ end) of the antisense strand as well as 2-4, 3, or 2 or 1 nucleotide(s) (at 3′ end or at 5′ end) of the sense strand. In certain exemplary embodiments, see Ex.6, constructs 6.1, 6.2, and 6.3, the RNAi agent comprises 2 nucleotide overhang at the 3′ end of the antisense strand and 2 nucleotide overhang at 3′ end of the sense strand. In certain other exemplary embodiments, see Ex. 7, constructs 7.1 and 7.3, Ex. 8, constructs 8.1 and 8.3; and Ex. 9, constructs 9.1 and 9.3, the RNAi agents comprise 2 nucleotide overhang at the 3′ end of the antisense strand and are blunt-ended on the other end. In certain other exemplary embodiment, see Ex. 7, construct 7.3, the construct is blunt-ended on both ends. In another exemplary embodiment, see Ex. 9, construct 9.2, the RNAi agent comprises 4 nucleotide overhang in the 3′ end of the antisense strand and blunt-ended on the other end.
In certain embodiments, the constructs are modified with a degradation protective moiety that prevents or inhibits nuclease cleavage by using a terminal cap, one or more inverted abasic nucleotides, one or more phosphorothioate linkages, one of more deoxynucleotides (e.g., D-ribonucleotide, D-2′-deoxyribonucleotide or another modified nucleotide), or a combination thereof. Such degradation protective moieties may be present at any one or all ends that are not conjugated to the ASGP-R ligand. In certain embodiments, the degradation protective moiety is chosen alone or as any combination from a group consisting of 1-4, 1-3, 1-2, or 1 phosphorothioate linkages, 1-4 1-3, 1-2, or 1 deoxynucleotides, and 1-4, 1-3, 1-2, or 1 inverted abasic nucleotides. In certain exemplary embodiments, the degradation protective moieties are configured as in one of the constructs 6.1, 6.2, 6.3, 7.1, 7.2, 7.3, 8.1, 8.2, 8.3, 9.1, 9.2, and 9.3, as shown in the Examples 6-15. Such exemplary protective moieties' configurations can be used in conjunction with any RNAi agents of the invention.
In certain embodiments, all or some riboses of the nucleotides in the sense and/or antisense strand (s) are modified. In certain embodiments, at least 50%, 60%, 70%, 80%, 90% or more (e.g., 100%) of riboses in the RNAi agent are modified. In certain embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more riboses are not modified.
In preferred embodiments, ribose modifications include 2′ substituent groups such as 2′-O-alkyl modifications, including 2′-O-methyl, and 2′-deoxyfluoro. Additional modifications are known in the art, including 2′-deoxy, LNA (e.g., 2′-0, 4′—C methylene bridge or 2′-0, 4′—C ethylene bridge), 2′-methoxythoxy (MOE), 2′-O—(CH 2 )OCH 3 , etc.
In certain embodiments, a number of modifications provide a distinct pattern of modifications, for example, as shown in constructs in the Examples 6-15, or as described in U.S. Pat. Nos. 7,452,987; 7,528,188; 8,273,866; 9,150,606; and 10,266,825; all of which are incorporated by reference herein.
In some embodiments, the siRNA comprises one or more thermally destabilizing nucleotides, e.g., GNA, ENA, etc., for example, at positions 11 (preferred), 12, 13 of the antisense strand and/or positions 9 and 10 (preferred) of the sense strand.
Additionally, nucleic acid bases could be modified, for example, at the C4 position as described in U.S. Pat. No. 10,119,136.
In general, the RNAi agents of the invention are directed against therapeutic targets, inhibition of which will result in prevention, alleviation, or treatment of a disease, including undesirable or pathological conditions. A great number of such targets is known in the art. Non-limiting examples of such targets include: ApoC, ApoB, ALAS1, TTR, GO, C5 (see Examples), etc. Generally, due to the abundant expression of ASGP-R on the surface of hepatocytes, such targets are preferably expressed in the liver, however, they could also be expressed in other tissues or organs. In preferred embodiments, targets are human, while the RNAi agent comprise an antisense strand fully or partially complementary to such a target. In certain embodiments, the RNAi agents may comprise two or more chemically linked RNAi agents directed against the same or different targets.
Example 6: Inverted Abasic Chemistry with 5′-GalNAc
In all RNAi agents depicted in the Examples, the following conventions are used:
•
• ia=inverted abasic nucleotide; • m=2′-O-methyl nucleotide; • f=2′-deoxy-2′-fluoro nucleotide; • s=phosphorothioate internucleotide linkage; • Xd=2′-deoxy-nucleotide; • ˜=tether.
Using standard synthesis techniques, the following constructs are synthesized in various versions, with tethers 1 and 2, and with various tri-antennary GalNAc units according to the invention, as described above or depicted in A- 27 B .
6.1.
(Top strand (sense (ss)): SEQ ID NO: 1; bottom strand (antisense) SEQ ID NO: 2)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23
5′ GalNAc~Gm-Am-Cm-Um-Um-Um-Cf-Am-Uf-Cf-Cf-Um-Gm-Gm-Am-Am-Am-Um-Ams UmsAm-ia-ia 3′
3′ AmsCms-Cm-Um-Gm-Am-Am-Af-Gm-Uf-Am-Gm-Gm-Am-Cf-Cf-Um-Uf-Um-Am-UmsAfsUm 5′
23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1
6.2.
(Top strand (sense (ss)): SEQ ID NO: 3; bottom strand (antisense) SEQ ID NO: 4)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23
5′ GalNAc~Am-Am-Gf-Cm-Af-Am-Gf-Am-Uf-Af-Uf-Um-Uf-Um-Um-Af-Um-Af-AmsUmsAm-ia-ia 3′
3′ Td-Td-UmsUmsUm-Um-Cm-Gf-Um-Uf-Cm-Uf-Am-Um-Am-Af-Am-Af-Am-Um-Af-Um-UfsAfsUm 5′
25 25 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1
6.3.
(Top strand (sense (ss)): SEQ ID NO: 5; bottom strand (antisense) SEQ ID NO: 6)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23
5′ GalNAc~Um-Gm-Gm-Gm-Am-Um-Uf-Um-Cf-Af-Uf-Gm-Um-Am-Am-Cm-Cm-Am-AmsGmsAm-ia-ia 3′
3′ CmsUmsAm-Cm-Cm-Cm-Um-Af-Am-Af-Gm-Um-Am-Cm-Af-Um-Um-Gf-Gm-Um-UmsCfsUm 5′
23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1
Example 7: Inverted Abasic Chemistry with 3′-GalNAc
Using standard synthesis techniques, the following constructs are synthesized in various versions, with tethers 1 and 2 according to the invention, and with various tri-antennary GalNAc units according to the invention, as described above or depicted in A- 27 B . Same sequences as in Example 6 are shown for consistency.
7.1
(Top strand (sense (ss)): SEQ ID NO: 7; bottom strand (antisense) SEQ ID NO: 8)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23
5′ ia-ia-GmsAmsCm-Um-Um-Um-Cf-Am-Uf-Cf-Cf-Um-Gm-Gm-Am-Am-Am-Um-Am-Um-Am~GalNAc 3′
3′ AmsCmsCm-Um-Gm-Am-Am-Af-Gm-Uf-Am-Gm-Gm-Am-Cf-Cf-Um-Uf-Um-Am-UmsAfsUm 5′
23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1
7.2
(Top strand (sense (ss)): SEQ ID NO: 9; bottom strand (antisense) SEQ ID NO: 10)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23
5′ ia-ia-AmsAmsGf-Cm-Af-Am-Gf-Am-Uf-Af-Uf-Um-Uf-Um-Um-Af-Um-Af-Am-Um-Am~GalNAc 3′
3′ Td-Td-UmsUmsUm-Um-Cm-Gf-Um-Uf-Cm-Uf-Am-Um-Am-Af-Am-Af-Am-Um-Af-Um-UfsAfsUm 5′
25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1
7.3.
(Top strand (sense (ss)): SEQ ID NO: 11; bottom strand (antisense) SEQ ID NO: 12)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23
5′ ia-ia-UmsGmsGm-Gm-Am-Um-Uf-Um-Cf-Af-Uf-Gm-Um-Am-Am-Cm-Cm-Am-Am-Gm-Am~GalNAc 3′
3′ CmsUmsAm-Cm-Cm-Cm-Um-Af-Am-Af-Gm-Um-Am-Cm-Af-Um-Um-Gf-Gm-Um-UmsCfsUm 5′
23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1
Example 8: Inverted Abasic Chemistry with 5′-GalNAc with Alternative Modification Patterns
Using standard synthesis techniques, the following constructs are synthesized in various versions, with tethers 1 and 2 according to the invention, and with various tri-antennary GalNAc units according to the invention, as described above or depicted in A- 27 B . Same sequences as in Example 6 are shown here for consistency.
8.1.
(Top strand (sense (ss)): SEQ ID NO: 13; bottom strand (antisense) SEQ ID NO: 14)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21
5′ GalNAc~Gf-Am-Cf-Um-Uf-Um-Cf-Am-Uf-Cm-Cf-Um-Gf-Gm-Af-Am-Af-Um-AfsUmsAf 3′
3′ AmsCfsCm-Uf-Gm-Af-Am-Af-Gm-Uf-Am-Gf-Gm-Af-Cm-Cf-Um-Uf-Um-Af-UmsAfsUm 5′
23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1
8.2
(Top strand (sense (ss)): SEQ ID NO: 15; bottom strand (antisense) SEQ ID NO: 16)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21
5′ GalNAc~Af-Am-Gf-Cm-Af-Am-Gf-Am-Uf-Am-Uf-Um-Uf-Um-Uf-Am-Uf-Am-AfsUmsAf 3′
3′ Td-Td-UmsUfsUm-Uf-Cm-Gf-Um-Uf-Cm-Uf-Am-Uf-Am-Af-Am-Af-Am-Uf-Am-Uf-UmsAfsUm 5′
25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1
8.3.
(Top strand (sense (ss)): SEQ ID NO: 17; bottom strand (antisense) SEQ ID NO: 18)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21
5′ GalNAc~Uf-Gm-Gf-Gm-Af-Um-Uf-Um-Cf-Am-Uf-Gm-Uf-Am-Af-Cm-Cf-Am-AfsGmsAf 3′
3′ CmsUfsAm-Cf-Cm-Cf-Um-Af-Am-Af-Gm-Uf-Am-Cf-Am-Uf-Um-Gf-Gm-Uf-UmsCfsUm 5′
23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1
Example 9: Inverted Abasic Chemistry with 5′-GalNAc with Alternative Modification Patterns
Using standard synthesis techniques, the following constructs are synthesized in various versions, with tethers 1 and 2 according to the invention, and with various tri-antennary GalNAc units according to the invention, as described above or depicted in A- 27 B . Same sequences as in Example 6 are shown for consistency.
9.1.
(Top strand (sense (ss)): SEQ ID NO: 19; bottom strand (antisense) SEQ ID NO: 20)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21
5′ GfsAmsCf-Um-Uf-Um-Cf-Am-Uf-Cm-Cf-Um-Gf-Gm-Af-Am-Af-Um-Af-Um-Af~GalNAc 3′
3′ AmsCfsCm-Uf-Gm-Af-Am-Af-Gm-Uf-Am-Gf-Gm-Af-Cm-Cf-Um-Uf-Um-Af-UmsAfsUm 5′
23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1
9.2
(Top strand (sense (ss)): SEQ ID NO: 21; bottom strand (antisense) SEQ ID NO: 22)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21
5′ AfsAmsGf-Cm-Af-Am-Gf-Am-Uf-Am-Uf-Um-Uf-Um-Uf-Am-Uf-Am-Af-Um-Af~GalNAc 3′
3′ Td-Td-UmsUfsUm-Uf-Cm-Gf-Um-Uf-Cm-Uf-Am-Uf-Am-Af-Am-Af-Am-Uf-Am-Uf-UmsAfsUm 5′
25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1
9.3
(Top strand (sense (ss)): SEQ ID NO: 23; bottom strand (antisense) SEQ ID NO: 24)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21
5′ UfsGmsGf-Gm-Af-Um-Uf-Um-Cf-Am-Uf-Gm-Uf-Am-Af-Cm-Cf-Am-Af-Gm-Af~GalNAc 3′
3′ CmsUfsAm-Cf-Cm-Cf-Um-Af-Am-Af-Gm-Uf-Am-Cf-Am-Uf-Um-Gf-Gm-Uf-UmsCfsUm 5′
23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1
Example 10: Benchmarking of siRNA-GalNAc Conjugates
The constructs used in Examples 6-15 are referred to by their numbers and are listed in Table 12. Tether 1 and Tether 2 are shown in respectively.
TABLE 12
Construct Target A (GO) Target B (C5) Target C (TTR)
Tether 1 6.1 6.2 6.3
Tether 2 6.1 6.2 6.3
Tether 1 8.1 8.2 8.3
Tether 2 8.1 8.2 8.3
Tether 1 7.1 7.2 7.3
Tether 2 7.1 7.2 7.3
Tether 1 9.1 9.2 9.3
Tether 2 9.1 9.2 9.3
3′-GalNAc control
(eg see )
The following Table 13 reflects benchmarking to be performed with various select constructs of the invention.
TABLE 13
In vitro Experiments for Benchmarking siRNA-GalNAc
Target A B C
In Human ASPGR Human ASPGR ASPGR
Vitro Primary human Primary human Human Primary human
siRNA hepatocyte hepatocyte hepatocyte hepatocyte hepatocyte hepatocyte
Group Benchmark RNAI agents uptake binding uptake binding uptake binding
1 tether option 1 at 5′-end of sense strand 0, 4 (update), Determine 0, 4 (update), Determine 0, 4 (update), Determine
Inverted abasic chemistry and 24 hr KD for and 24 hr KD for and 24 hr KD for
2 tether option 2 at 5′-end of sense strand (silencing) ASPGR (silencing) ASPGR (silencing) ASPGR
Inverted abasic chemistry incubations, binding incubations, binding with incubations, or binding with
3 tether option 1 at 5′ end of sense strand or Hep3B with or Hep3B SIRNA- Hep3B siRNA-
Alternating chemistry Transfection siRNA- Transfection GaINAc Transfection GaINAc
4 tether option 2 at 5′-end of sense strand w/RNAiMax GaINAc w/RNAiMax w/RNAiMax
Alternating Chemistry for 24 h for 24 h for 24 h
5 tether option 1 at 3′-end of sense strand
Inverted abasic chemistry
6 tether option 2 at 3′-end of sense strand
Inverted abasic chemistry
7 tether option 1 at 3′-end of sense strand
Alternating chemistry
8 tether option 2 at 3′ end of sense strand
Alternating chemistry
9 3′-GalNAc control (eg see )
In Vitro Pharmacodynamic Characterization
The in vitro pharmacodynamics activity, binding affinity, and liver uptake for 8 constructs, listed in Table 12 (GO1 siRNA-GalNAc, C5 siRNA-GalNAc, and TTR siRNA-GalNAc analogues) are benchmarked against the clinically validated versions of these molecules.
Human Liver Cell Line (HepG2 or Hep3B) Transfection Assay—Each GO1 siRNA-GalNAc, C5 siRNA-GalNAc, and TTR siRNA-GalNAc analogue molecule is incubated at 37° C. for 0 and 24 hours at 10 different concentrations in human liver cell line in the presence of transfection reagent (e.g RNAiMAX). All incubations at each concentration are run in quadruplicate. Following incubations, each sample is lysed and analyzed for HAG1 C5, TTR and housekeeping gene (such as GAPDH) mRNA concentrations by bDNA or RT-qPCR assay. mRNA concentrations data obtained is used for analysis to determine the silencing activity and IC 50 for each of the GO1 siRNA-GalNAc, C5 siRNA-GalNAc, and TTR siRNA-GalNAc molecules.
Primary Human Hepatocytes Uptake Assay—The liver uptake and silencing activity for each of the GO1 siRNA-GalNAc, C5 siRNA-GalNAc, and TTR siRNA-GalNAc molecules are evaluated in primary human hepatocytes. Each GO1 siRNA-GalNAc, C5 siRNA-GalNAc, and TTR siRNA-GalNAc analogues molecule is incubated at 37° C. for 0, 4, and 72 hours at 10 different concentrations in primary human hepatocytes. All incubations at each concentration are run in quadruplicate. Following incubations, each sample is lysed and analyzed for HAO1, C5, TTR and housekeeping gene(s) (such as GAPDH) mRNA concentrations by bDNA or RT-qPCR assay. mRNA concentrations data obtained are used for analysis to determine the silencing activity, uptake and IC 50 for each of the GO1 siRNA-GalNAc, C5 siRNA-GalNAc, and TTR siRNA-GalNAc molecules.
In Vivo Pharmacodynamic Characterization
The in vivo pharmacodynamics activity for 8 constructs each of GO1 siRNA-GalNAc, C5 siRNA-GalNAc, and TTR siRNA-GalNAc analogues is compared to the in vivo pharmacodynamic activity of clinically validated of each GO1siRNA-GalNAc, C5 siRNA-GalNAc, and TTR siRNA-GalNAc molecules following a single subcutaneous administration to male mice or cynomolgus monkeys.
For the in vivo mice pharmacology of GO1 siRNA-GalNAc of each of analogues is evaluated following a single subcutaneous dose at 0.3 or 3 mg/kg as provided in Table 14 below. There are 2 dose groups in which each of the GO1 siRNA-GalNAc analogues is administered subcutaneously to C57BL/6 male mice (n=3/timepoint/group) at 0.3 or 1 mg/kg. Blood samples to obtain serum samples and liver biopsy samples are obtained at various time points to determine the concentration of serum glycolate by LCMS and to determine the concentration of HAO1 mRNA by RT-qPCR or bDNA assay. The animals from each group at each specified time point are sacrificed and blood (approximately 0.5 mL/animal) and liver (approximately 100 mg) are collected. For Groups 1 through 9, blood (approximately 0.5 mL/animal) and liver (approximately 100 mg) are collected from 3 animals/time point/group at 24, 48, 96, 168, 336, 504, and 672 hours post-dosing. Group 10 (n=3) is a control group that is not dosed to provide baseline values for serum glycolate and mRNA HAO1 concentrations. The pharmacodynamic effect of the increase of serum glycolate and the silencing of HAO1 mRNA in the liver at various time points post-dosing is compared to the Group 10 control serum and liver samples.
TABLE 14
GO1 siRNA-GalNAc Analogues Mice Pharmacology Study Design
Target
Number of Number Target Dose Target Dose Dose
Animals Dose of Level Concentration Volume
Group Male Route Doses/Animal (mg/kg) (mg/mL) (mL/kg)
1 21 SC 1 0.3 or 3 3 1.5
2 21 SC 1 0.3 or 3 3 1.5
3 21 SC 1 0.3 or 3 3 1.5
4 21 SC 1 0.3 or 3 3 1.5
5 21 SC 1 0.3 or 3 3 1.5
6 21 SC 1 0.3 or 3 3 1.5
7 21 SC 1 0.3 or 3 3 1.5
8 21 SC 1 0.3 or 3 3 1.5
9 21 SC 1 0.3 or 3 3 1.5
10 a 5 NA NA NA NA NA
Table Legend:
SC Subcutaneous
NA Not Applicable
a Group 10 animals are control animals and are not be dosed
c Animals in Groups 1 to 9 are dosed on Day 1
Example 11: 5′ Conjugation Using Click-Chemistry (Option 1)
In this embodiment, the sense strand of the oligonucleotide 101 is synthesized on solid support and coupled with the commercially available octyne amidite 102 to give the required oligonucleotide with the click chemistry precursor on the solid support. This after standard cleavage and deprotection provides the pure oligo nucleotide 103. The azide 104 is dissolved in DMSO (150 μL/mg) and this solution is added to 10 OD of oligo 103 in 100 μL of water. The reaction mixture is then incubated at room temperature overnight. The conjugated oligo 105 is desalted on a Glen Gel-Pak™ to remove organics and the acetoxy protecting groups were removed by treating with methylamine followed by prep HPLC to give pure Oligo 106 which is annealed with an equimolar amount of sense strand to give the final duplex.
Example 12: 5′ Conjugation (Option 2)
In this embodiment, the sense strand of the oligonucleotide 101 is synthesized on solid support and coupled with the commercially available amidite 108 to give the required oligonucleotide on the solid support. This after standard cleavage and deprotection provides the pure oligo nucleotide 109. The amine 109 is dissolved in water (15 μL/OD) and this solution is added to a solution of the acid 110 in DMSO (100 mL/mg) followed by 10 molar equivalents of EDC and 10 equivalents of HOBT and the reaction mixture is incubated at room temperature overnight. The conjugated oligo 111 is then desalted on a Glen Gel-Pak™ to remove organics and the acetoxy protecting groups were removed by treating with methylamine followed by prep HPLC to give pure Oligo 112 which is annealed with an equimolar amount of sense strand to give the final duplex.
Example 13: 5′ Conjugation Using Click-Chemistry (Option 1)
For the synthesis of oligo construct 119 a similar approach is adapted where the triantennary GalNAc conjugate is loaded on to the solid support 118 (CPG) and the oligo synthesis is performed. After cleavage and deprotection and purification provides the pure oligo 119 which is annealed with antisense strand to give the required final duplex in a pure form. In another approach the 3′ conjugate is also synthesized analogous to the synthesis of 116 starting from amino linked oligo 113 and post synthetically conjugating the GalNAc carboxylic acid to give the conjugated oligo 119.
Example 14: 3′ Conjugation (Option 2)
For the synthesis of oligo construct 119 a similar approach is adapted where the tri-antennary GalNAc conjugate is loaded on to the solid support 118 (CPG) and the oligo synthesis is performed. After cleavage and deprotection and purification provided the pure oligo 119 which is annealed with antisense strand to give the required final duplex in a pure form. In another approach, the 3′ conjugate is also synthesized analogous to the synthesis of 116 starting from amino linked oligo 113 and post synthetically conjugating the GalNAc carboxylic acid to give the conjugated oligo 119.
Example 15: Post-Synthetic Conjugation Approach
In this approach, the 3′ conjugate is also synthesized analogous to the synthesis of 116 starting from amino linked oligo 113 and post synthetically conjugating the GalNAc carboxylic acid to give the conjugated oligo 121 which is annealed with antisense strand to give the required final duplex in a pure form.
The preceding Examples are not intended to be limiting. Those of skill in the art will, in light of the present disclosure, appreciate that many changes can be made in the specific materials and which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
EXEMPLARY EMBODIMENTS
1. A modified RNAi agent comprising an RNA interference compound (RNAi compound) conjugated via a tether to an ASGP-R ligand, wherein the tether comprises:
wherein m is chosen from 0, 1, 2, 3, 4, or 5, and p is chosen from 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14, independently of m; and X is chosen from O and CH 2 .
2. The modified RNAi agent of statement 1, wherein m=1.
3. The modified RNAi agent of statement 1, wherein x is O.
4. The modified RNAi agent of statement 1, wherein p=6.
5. The modified RNAi agent of statement 1, wherein m=1, p=6, and x is O.
6. The modified RNAi agent of statement 1, wherein the ASGP-R ligand comprises a branched GalNAc.
7. The modified RNAi agent of statement 6, wherein the branched GalNAc is selected from the group consisting of:
wherein n is 0, 1, 2, 3, or 4.
8. The modified RNAi agent of statement 7, wherein n=1.
9. The modified RNAi agent of statement 6, wherein the branched GalNAc comprises
or a bi-antennary form thereof.
10. The modified RNAi agent of statement 6, wherein the branched GalNAc comprises or a bi-antennary form thereof.
or a bi-antennary form thereof.
11. The modified RNAi agent of statement 1, wherein the tether is attached to the 5′ end of the sense strand.
12. The modified RNAi agent of statement 11, wherein the tether is attached as shown in Formula IV*.
wherein Z is P or S.
13. The modified RNAi agent of statement 11, wherein the tether is attached to the 3′ end of the sense strand.
14. The modified RNAi agent of statement 13, wherein the tether is attached as shown in Formulae V*-a or V*-b:
15. The modified RNAi agent of statement 1, as shown in A, 26 B, 26 C , or 26 D.
16. The modified RNAi agent of statement 15, wherein the RNAi compound comprises modified riboses that are modified at the 2′ position.
17. The modified RNAi agent of statement 16, wherein the modifications are chosen from 2′-O-methyl, 2′-deoxy-fluoro, and 2′-deoxy.
18. The modified RNAi agent of statement 1, wherein RNAI compound contains one or more degradation protective moieties at any or all ends that are not conjugated to the ASGP-R ligand.
19. The modified RNAi agent of statement 18, wherein the degradation protective moiety is chosen alone or as any combination from a group consisting of 1-4 phosphorothioate linkages, 1-4 deoxynucleotides, and 1-4 inverted abasic nucleotides.
20. The modified RNAi agent of statement 19, wherein the degradation protective moieties are chosen from the configuration present in one of the following constructs 6.1, 6.2, 6.3, 7.1, 7.2, 7.3, 8.1, 8.2, 8.3, 9.1, 9.2, and 9.3.
21. A modified RNAi agent comprising an RNA interference compound (RNAi compound) conjugated via a tether to an ASGP-R ligand, wherein the tether comprises:
wherein q is chosen from 1, 2, 3, 4, 5, 6, 7, or 8.
22. The modified RNAi agent of statement 21, wherein q=1.
23. The modified RNAi agent of statement 21, wherein the ASGP-R ligand comprises a branched GalNAc.
24. The modified RNAi agent of statement 23, wherein the branched GalNAc is selected from the group consisting of:
wherein n is 0, 1, 2, 3, or 4.
25. The modified RNAi agent of statement 24, wherein n=1.
26. The modified RNAi agent of statement 23, wherein the branched GalNAc comprises Formula VI*
or a bi-antennary form thereof.
27. The modified RNAi agent of statement 23, wherein the branched GalNAc comprises or a bi-antennary form thereof.
or a bi-antennary form thereof.
28. The modified RNAi agent of statement 21, wherein the tether is attached to the 5′ end of the sense strand.
29. The modified RNAi agent of statement 28, wherein the tether is attached as shown in Formula IV*.
wherein Z is P or S.
30. The modified RNAi agent of statement 28, wherein the tether is attached to the 3′ end of the sense strand.
31. The modified RNAi agent of statement 30, wherein the tether is attached as shown in Formulae V*-a or V*-b:
32. The modified RNAi agent of statement 31, as shown in A, 27 B, 27 C , or 27 D.
33. The modified RNAi agent of statement 21, wherein the RNAi compound comprises modified riboses that are modified at the 2′ position.
34. The modified RNAi agent of statement 33, wherein the modifications are chosen from 2′-O-methyl, 2′deoxy-fluoro, and 2′-deoxy.
35. The modified RNAi agent of statement 21, wherein siRNA contains one or more degradation protective moieties at any or all ends that are not conjugated to the ASGP-R ligand.
36. The modified RNAi agent of statement 35, wherein the degradation protective moiety is chosen alone or as any combination from a group consisting of 1-4 phosphorothioate linkages, 1-4 deoxynucleotides, and 1-4 inverted abasic nucleotides.
37. The modified RNAi agent of statement 36, wherein the degradation protective moieties are chosen from the configuration present in one of the following constructs 6.1, 6.2, 6.3, 7.1, 7.2, 7.3, 8.1, 8.2, 8.3, 9.1, 9.2, and 9.3.
39. A method of making the RNAi agent of statements 1 or 2, said method being shown in Examples 11-15.
40. A method of preventing, alleviating, or treating a disease in a subject, the method comprising administering, to the subject, the RNAi agent of statements 1 or 2 in a therapeutically amount effective to prevent, alleviate or treat the disease, thereby preventing, alleviating, or treating a disease.
41. The method of statement 40, wherein the subject is human.
TABLE A
Summary of Sequences
Seq Duplex SSRN
ID ID ID Sense Sequence Antisense Sequence Clean Sequence
1. 5′ GalNAc~Gm-Am-Cm-Um-Um-Um-Cf-Am-Uf- gacuuucauccuggaaauaua
Cf-Cf-Um-Gm-Gm-Am-Am-Am-Um-
AmsUmsAm-ia-ia 3′
2. 3′ AmsCms-Cm-Um-Gm- accugaaaguaggaccuuuauau
Am-Am-Af-Gm-Uf-Am-Gm-
Gm-Am-Cf-Cf-Um-Uf-Um-
Am-UmsAfsUm 5′
3. 5′ GalNAc~Am-Am-Gf-Cm-Af-Am-Gf-Am- aagcaagauauuuuuauaaua
Uf-Af-Uf-Um-Uf-Um-Um-Af-Um-Af-
AmsUmsAm-ia-ia 3′
4. 3′ Td-Td-UmsUmsUm-Um- uuuucguucuauaaaaauauuau
Cm-Gf-Um-Uf-Cm-Uf-Am-
Um-Am-Af-Am-Af-Am-Um-
Af-Um-UfsAfsUm 5′
5. 5′GalNAc~Um-Gm-Gm-Gm-Am-Um-Uf-Um-Cf- ugggauuucauguaaccaaga
Af-Uf-Gm-Um-Am-Am-Cm-Cm-Am-
AmsGmsAm-ia-ia 3′
6. 3′ CmsUmsAm-Cm-Cm-Cm- cuacccuaaaguacauugguucu
Um-Af-Am-Af-Gm-Um-Am-
Cm-Af-Um-Um-Gf-Gm-Um-
UmsCfsUm 5′
7. 5′ ia-ia-GmsAmsCm-Um-Um-Um-Cf-Am-Uf-Cf- gacuuucauccuggaaauaua
Cf-Um-Gm-Gm-Am-Am-Am-Um-Am-Um-
Am~GalNAc 3′
8. 3′ AmsCmsCm-Um-Gm- accugaaaguaggaccuuuauau
Am-Am-Af-Gm-Uf-Am-Gm-
Gm-Am-Cf-Cf-Um-Uf-Um-
Am-UmsAfsUm 5′
9. 5′ ia-ia-AmsAmsGf-Cm-Af-Am-Gf-Am-Uf-Af- aagcaagauauuuuuauaaua
Uf-Um-Uf-Um-Um-Af-Um-Af-Am-Um-
Am~GalNAc 3′
10. 3′Td-Td-UmsUmsUm-Um- uuuucguucuauaaaaauauuau
Cm-Gf-Um-Uf-Cm-Uf-Am-
Um-Am-Af-Am-Af-Am-Um-
Af-Um-UfsAfsUm 5′
11. 5′ ia-ia-UmsGmsGm-Gm-Am-Um-Uf-Um-Cf-Af- ugggauuucauguaaccaaga
Uf-Gm-Um-Am-Am-Cm-Cm-Am-Am-Gm-
Am~GalNAc 3′
12. 3′ CmsUmsAm-Cm-Cm-Cm- cuacccuaaaguacauugguucu
Um-Af-Am-Af-Gm-Um-Am-
Cm-Af-Um-Um-Gf-Gm-Um-
UmsCfsUm 5′
13. 5′GalNAc~Gf-Am-Cf-Um-Uf-Um-Cf-Am-Uf-Cm- gacuuucauccuggaaauaua
Cf-Um-Gf-Gm-Af-Am-Af-Um-AfsUmsAf 3′
14. 3′ AmsCfsCm-Uf-Gm-Af- accugaaaguaggaccuuuauau
Am-Af-Gm-Uf-Am-Gf-Gm-
Af-Cm-Cf-Um-Uf-Um-Af-
UmsAfsUm 5′
15. 5′ GalNAc~Af-Am-Gf-Cm-Af-Am-Gf-Am-Uf- aagcaagauauuuuuauaaua
Am-Uf-Um-Uf-Um-Uf-Am-Uf-Am-AfsUmsAf 3′
16. 3′ Td-Td-UmsUfsUm-Uf- uuuucguucuauaaaaauauuau
Cm-Gf-Um-Uf-Cm-Uf-Am-
Uf-Am-Af-Am-Af-Am-Uf-
Am-Uf-UmsAfsUm 5′
17. 5′ GalNAc~Uf-Gm-Gf-Gm-Af-Um-Uf-Um-Cf- ugggauuucauguaaccaaga
Am-Uf-Gm-Uf-Am-Af-Cm-Cf-Am-AfsGmsAf 3′
18. 3′ CmsUfsAm-Cf-Cm-Cf- cuacccuaaaguacauugguucu
Um-Af-Am-Af-Gm-Uf-Am-
Cf-Am-Uf-Um-Gf-Gm-Uf-
UmsCfsUm 5′
19. 5′ GfsAmsCf-Um-Uf-Um-Cf-Am-Uf-Cm-Cf- gacuuucauccuggaaauaua
Um-Gf-Gm-Af-Am-Af-Um-Af-Um-Af~GalNAc
3′
20. 3′ AmsCfsCm-Uf-Gm-Af- accugaaaguaggaccuuuauau
Am-Af-Gm-Uf-Am-Gf-Gm-
Af-Cm-Cf-Um-Uf-Um-Af-
UmsAfsUm 5′
21. 5′ AfsAmsGf-Cm-Af-Am-Gf-Am-Uf-Am- aagcaagauauuuuuauaaua
Uf-Um-Uf-Um-Uf-Am-Uf-Am-Af-Um-
Af~GalNAc 3′
22. 3′ Td-Td-UmsUfsUm-Uf- uuuucguucuauaaaaauauuau
Cm-Gf-Um-Uf-Cm-Uf-Am-
Uf-Am-Af-Am-Af-Am-Uf-
Am-Uf-UmsAfsUm 5′
23. 5′ UfsGmsGf-Gm-Af-Um-Uf-Um-Cf-Am-Uf- ugggauuucauguaaccaaga
Gm-Uf-Am-Af-Cm-Cf-Am-Af-Gm-Af~GalNAc 3′
24. 3′ CmsUfsAm-Cf-Cm-Cf- cuacccuaaaguacauugguucu
Um-Af-Am-Af-Gm-Uf-Am-
Cf-Am-Uf-Um-Gf-Gm-Uf-
UmsCfsUm 5′
25. ETX005 (invabasic)(invabasic)gsascu gacuuucauccuggaaauaua
uuCfaUfCfCfuggaaauasusa
(NHC6)(MFCO)(ET-
GalNAc-T1N3)
26. ETX005 usAfsuauUfuCfCfaggaUfgAfaagucscsa uauauuuccaggaugaaagucca
27. ETX001 (ET-GalNAc- gacuuucauccuggaaauaua
T1N3)(MFCO)(NH-
DEG)gacuuuCfaUfCfCfugg
aaauasusa(invabasic)
(invabasic)
28. ETX001 usAfsuauUfuCfCfaggaUfgAfaagucscsa uauauuuccaggaugaaagucca
29. ETX014 (invabasic)(invabasic)asasGf aagcaagauauuuuuauaaua
cAfaGfaUfAfUfuUfuuAfuA
faua(NHC6)(MFCO)(ET-
GalNAc-T1N3)
30. ETX014 usAfsUfuAfuaAfaAfauaUfcUfuGfcuus uauuauaaaaauaucuugcuuuu
usudTdT
31. ETX010 (ET-GalNAc- aagcaagauauuuuuauaaua
T1N3)(MFCO)(NH-
DEG)aaGfcAfaGfaUfAfUfu
UfuuAfuAfasusa(invabasic)
(invabasic)
32. ETX010 usAfsUfuAfuaAfaAfauaUfcUfuGfcuus uauuauaaaaauaucuugcuuuu
usudTdT
33. ETX019 (ET-GalNAc- ugggauuucauguaaccaaga
T1N3)(MFCO)(NH-
DEG)ugggauUfuCfAfUfgua
accaasgsa(invabasic)
(invabasic)
34. ETX019 usCfsuugGfuuAfcaugAfaAfucccasusc ucuugguuacaugaaaucccauc
35. ETX023 (invabasic)(invabasic)usgsg ugggauuucauguaaccaaga
gauUfuCfAfUfguaaccaaga
(NHC6)(MFCO)(ET-
GalNAc-T1N3)
36. ETX023 usCfsuugGfuuAfcaugAfaAfucccasusc ucuugguuacaugaaaucccauc
37. XD- cuuAcGcuGAGuAcuucGAd cuuacgcugaguacuucga
00914 TsdT
38. XD- UCGAAGuACUcAGCGuAAGdTsdT ucgaaguacucagcguaag
00914
39. XD- AGAuAuGcAcAcAcAcGG agauaugcacacacacgga
03999 AdTsdT
40. XD- UCCGUGUGUGUGcAuAUCUdTsdT uccgugugugugcauaucu
03999
41. XD- uscsUfcGfuGfgCfcUfuAfaU ucucguggccuuaaugaaa
15421 fgAfaAf(invdT)
42. XD- UfsUfsuCfaUfuAfaGfgCfcAfcGfaGfas uuucauuaaggccacgagauu
15421 usu
43. X91382 (NH2- gacuuucauccuggaaauaua
DEG)gacuuuCfaUfCfCfugg
aaauasusa(invabasic)
(invabasic)
44. X91383 (NH2- aagcaagauauuuuuauaaua
DEG)aaGfcAfaGfaUfAfUfu
UfuuAfuAfasusa(invabasic)
(invabasic)
45. X91384 (NH2- ugggauuucauguaaccaaga
DEG)ugggauUfuCfAfUfgua
accaasgsa(invabasic)
(invabasic)
46. X91403 (NH2C12)gacuuuCfaUfCfC gacuuucauccuggaaauaua
fuggaaauasusa(invabasic)
(invabasic)
47. X91404 (NH2C12)aaGfcAfaGfaUfA aagcaagauauuuuuauaaua
fUfuUfuuAfuAfasusa(invabasic)
(invabasic)
48. X91405 (NH2C12)ugggauUfuCfAfU ugggauuucauguaaccaaga
fguaaccaasgsa(invabasic)
(invabasic)
49. X91415 (invabasic)(invabasic)gsascu gacuuucauccuggaaauaua
uuCfaUfCfCfuggaaauasusa
(NH2C6)
50. X91416 (invabasic)(invabasic)asasGf aagcaagauauuuuuauaaua
cAfaGfaUfAfUfuUfuuAfuA
faua(NH2C6)
51. X91417 (invabasic)(invabasic)usgsg ugggauuucauguaaccaaga
gauUfuCfAfUfguaaccaaga
(NH2C6)
52. X91379 gsascuuuCfaUfCfCfuggaaau gacuuucauccuggaaauaua
aua(GalNAc)
53. X91380 asasGfcAfaGfaUfAfUfuUfu aagcaagauauuuuuauaaua
uAfuAfaua(GalNAc)
54. X91446 usgsggauUfuCfAfUfguaacca ugggauuucauguaaccaaga
aga(GalNAc)
55. X38483 usAfsuauUfuCfCfaggaUfgA uauauuuccaggaugaaagucca
faagucscsa
56. X91381 usAfsUfuAfuaAfaAfauaUfc uauuauaaaaauaucuugcuuuu
UfuGfcuususudTdT
57. X38104 usCfsuugGfuuAfcaugAfaAf ucuugguuacaugaaaucccauc
ucccasusc
58. X91388 (MFCO)(NH- gacuuucauccuggaaauaua
DEG)gacuuuCfaUfCfCfugg
aaauasusa(invabasic)
(invabasic)
59. X91389 (MFCO)(NH- aagcaagauauuuuuauaaua
DEG)aaGfcAfaGfaUfAfUfu
UfuuAfuAfasusa(invabasic)
(invabasic)
60. X91390 (MFCO)(NH- ugggauuucauguaaccaaga
DEG)ugggauUfuCfAfUfgua
accaasgsa(invabasic)
(invabasic)
61. X91421 (invabasic)(invabasic)gsascu gacuuucauccuggaaauaua
uuCfaUfCfCfuggaaauasusa
(NHC6)(MFCO)
62. X91422 (invabasic)(invabasic)asasGf aagcaagauauuuuuauaaua
cAfaGfaUfAfUfuUfuuAfuA
faua(NHC6)(MFCO)
63. X91423 (invabasic)(invabasic)usgsg ugggauuucauguaaccaaga
gauUfuCfAfUfguaaccaaga
(NHC6)(MFCO)
64. X91394 (GalNAc-T1)(MFCO)(NH- gacuuucauccuggaaauaua
DEG)gacuuuCfaUfCfCfugg
aaauasusa(invabasic)
(invabasic)
65. X91395 (GalNAc-T1)(MFCO)(NH- aagcaagauauuuuuauaaua
DEG)aaGfcAfaGfaUfAfUfu
UfuuAfuAfasusa(invabasic)
(invabasic)
66. X91396 (GalNAc-T1)(MFCO)(NH- ugggauuucauguaaccaaga
DEG)ugggauUfuCfAfUfgua
accaasgsa(invabasic)
(invabasic)
67. X91427 (invabasic)(invabasic)gsascu gacuuucauccuggaaauaua
uuCfaUfCfCfuggaaauasusa
(NHC6)(MFCO)(GalNAc-
T1)
68. X91428 (invabasic)(invabasic)asasGf aagcaagauauuuuuauaaua
cAfaGfaUfAfUfuUfuuAfuA
faua(NHC6)(MFCO)
(GalNAc-T1)
69. X91429 (invabasic)(invabasic)usgsg ugggauuucauguaaccaaga
gauUfuCfAfUfguaaccaaga
(NHC6)(MFCO)(GalNAc-
T1)
70. ETX001 X91394 (GalNAc- gacuuucauccuggaaauaua
T1)(MFCO)(NHDEG)gacuu
uCfaUfCfCfuggaaauasusa
(invabasic)(invabasic)
71. X38483 usAfsuauUfuCfCfaggaUfgA uauauuuccaggaugaaagucca
faagucscsa
72. ETX005 X91427 (invabasic)(invabasic)gsascu gacuuucauccuggaaauaua
uuCfaUfCfCfuggaaauasusa
(NHC6)(MFCO)(GalNAc-
T1)
73. X38483 usAfsuauUfuCfCfaggaUfgA uauauuuccaggaugaaagucca
faagucscsa
74. ETX010 X91395 (GalNAc-T1)(MFCO)(NH- aagcaagauauuuuuauaaua
DEG)aaGfcAfaGfaUfAfUfu
UfuuAfuAfasusa(invabasic)
(invabasic)
75. X91381 usAfsUfuAfuaAfaAfauaUfc uauuauaaaaauaucuugcuuuu
UfuGfcuususudTdT
76. ETX014 X91428 (invabasic)(invabasic)asasGf aagcaagauauuuuuauaaua
cAfaGfaUfAfUfuUfuuAfuA
faua(NHC6)(MFCO)
(GalNAc-T1)
77. X91381 usAfsUfuAfuaAfaAfauaUfc uauuauaaaaauaucuugcuuuu
UfuGfcuususudTdT
78. ETX019 X91396 (GalNAc-T1)(MFCO)(NH- ugggauuucauguaaccaaga
DEG)ugggauUfuCfAfUfgua
accaasgsa(invabasic)
(invabasic)
79. X38104 usCfsuugGfuuAfcaugAfaAf ucuugguuacaugaaaucccauc
ucccasusc
80. ETX023 X91429 (invabasic)(invabasic)usgsg ugggauuucauguaaccaaga
gauUfuCfAfUfguaaccaaga
(NHC6)(MFCO)(GalNAc-
T1)
81. X38104 usCfsuugGfuuAfcaugAfaAf ucuugguuacaugaaaucccauc
ucccasusc
82. ETX006 (invabasic)(invabasic)gsascu gacuuucauccuggaaauaua
uuCfaUfCfCfuggaaauasusa
(NHC6)(ET-GalNAc-T2CO)
83. ETX006 usAfsuauUfuCfCfaggaUfgAfaagucscsa uauauuuccaggaugaaagucca
84. ETX002 (ET-GalNAc- gacuuucauccuggaaauaua
T2CO)(NH2C12)gacuuuCfa
UfCfCfuggaaauasusa
(invabasic)(invabasic)
85. ETX002 usAfsuauUfuCfCfaggaUfgAfaagucscsa uauauuuccaggaugaaagucca
86. ETX004 (ET-GalNAc- gacuuucauccuggaaauaua
T2CO)(NH2C12)GfaCfuUf
uCfaUfcCfuGfgAfaAfuAfsu
sAf
87. ETX004 usAfsuAfuUfuCfcAfgGfaUfgAfaAfgUf uauauuuccaggaugaaagucca
csCfsa
88. ETX008 GfsasCfuUfuCfaUfcCfuGfg gacuuucauccuggaaauaua
AfaAfuAfuAf(NHC6)(ET-
GalNAc-T2CO)
89. ETX008 usAfsuAfuUfuCfcAfgGfaUfgAfaAfgUf uauauuuccaggaugaaagucca
csCfsa
90. ECX008 GfsasCfuUfuCfaUfcCfuGfg gacuuucauccuggaaauaua
(lower AfaAfuAfuAf(NHC6)(ET-
purity) GalNAc-T2CO)
91. ECX008 usAfsuAfuUfuCfcAfgGfaUfgAfaAfgUf uauauuuccaggaugaaagucca
(lower csCfsa
purity)
92. ETX011 (ET-GalNAc- aagcaagauauuuuuauaaua
T2CO)(NH2C12)aaGfcAfa
GfaUfAfUfuUfuuAfuAfasus
a(invabasic)(invabasic)
93. ETX011 usAfsUfuAfuaAfaAfauaUfcUfuGfcuus uauuauaaaaauaucuugcuuuu
usudTdT
94. ETX015 (invabasic)(invabasic)asasGf aagcaagauauuuuuauaaua
cAfaGfaUfAfUfuUfuuAfuA
faua(NHC6)(ET-GalNAc-
T2CO)
95. ETX015 usAfsUfuAfuaAfaAfauaUfcUfuGfcuus uauuauaaaaauaucuugcuuuu
usudTdT
96. ETX013 (ET-GalNAc- aagcaagauauuuuuauaaua
T2CO)(NH2C12)AfaGfcAfa
GfaUfaUfuUfuUfaUfaAfsus
Af
97. ETX013 usAfsuUfaUfaAfaAfaUfaUfcUfuGfcUf uauuauaaaaauaucuugcuuuu
usUfsudTdT
98. ETX017 AfsasGfcAfaGfaUfaUfuUfu aagcaagauauuuuuauaaua
UfaUfaAfuAf(NHC6)(ET-
GalNAc-T2CO)
99. ETX017 usAfsuUfaUfaAfaAfaUfaUfcUfuGfcUf uauuauaaaaauaucuugcuuuu
usUfsudTdT
100. ETX020 (ET-GalNAc- ugggauuucauguaaccaaga
T2CO)(NH2C12)ugggauUfu
CfAfUfguaaccaasgsa
(invabasic)(invabasic)
101. ETX020 usCfsuugGfuuAfcaugAfaAfucccasusc ucuugguuacaugaaaucccauc
102. ETX022 (ET-GalNAc- ugggauuucauguaaccaaga
T2CO)(NH2C12)UfgGfgAf
uUfuCfaUfgUfaAfcCfaAfsg
sAf
103. ETX022 usCfsuUfgGfuUfaCfaUfgAfaAfuCfcCf ucuugguuacaugaaaucccauc
asUfsc
104. ETX024 (invabasic)(invabasic)usgsg ugggauuucauguaaccaaga
gauUfuCfAfUfguaaccaaga
(NHC6)(ET-GalNAc-T2CO)
105. ETX024 usCfsuugGfuuAfcaugAfaAfucccasusc ucuugguuacaugaaaucccauc
106. ETX026 UfsgsGfgAfuUfuCfaUfgUfa ugggauuucauguaaccaaga
AfcCfaAfgAf(NHC6)(ET-
GalNAc-T2CO)
107. ETX026 usCfsuUfgGfuUfaCfaUfgAfaAfuCfcCf ucuugguuacaugaaaucccauc
asUfsc
108. XD- cuuAcGcuGAGuAcuucGAd cuuacgcugaguacuucga
00914 TsdT
109. XD UCGAAGuACUcAGCGuAAGdTsdT ucgaaguacucagcguaag
00914
110. XD- AGAuAuGcAcAcAcAcGG agauaugcacacacacgga
03999 AdTsdT
111. XD- UCCGUGUGUGUGcAuAUCUdTsdT uccgugugugugcauaucu
03999
112. XD- uscsUfcGfuGfgCfcUfuAfaU ucucguggccuuaaugaaa
15421 fgAfaAf(invdT)
113. XD- UfsUfsuCfaUfuAfaGfgCfcAfcGfaGfas uuucauuaaggccacgagauu
15421 usu
114. X91382 (NH2- gacuuucauccuggaaauaua
DEG)gacuuuCfaUfCfCfugg
aaauasusa(invabasic)
(invabasic)
115. X91383 (NH2- aagcaagauauuuuuauaaua
DEG)aaGfcAfaGfaUfAfUfu
UfuuAfuAfasusa(invabasic)
(invabasic)
116. X91384 (NH2- ugggauuucauguaaccaaga
DEG)ugggauUfuCfAfUfgua
accaasgsa(invabasic)
(invabasic)
117. X91385 (NH2- gacuuucauccuggaaauaua
DEG)GfaCfuUfuCfaUfcCfu
GfgAfaAfuAfsusAf
118. X91386 (NH2- aagcaagauauuuuuauaaua
DEG)AfaGfcAfaGfaUfaUfu
UfuUfaUfaAfsusAf
119. X91387 (NH2- ugggauuucauguaaccaaga
DEG)UfgGfgAfuUfuCfaUfg
UfaAfcCfaAfsgsAf
120. X91403 (NH2C12)gacuuuCfaUfCfC gacuuucauccuggaaauaua
fuggaaauasusa(invabasic)
(invabasic)
121. X91404 (NH2C12)aaGfcAfaGfaUfA aagcaagauauuuuuauaaua
fUfuUfuuAfuAfasusa
(invabasic)(invabasic)
122. X91405 (NH2C12)ugggauUfuCfAfU ugggauuucauguaaccaaga
fguaaccaasgsa(invabasic)
(invabasic)
123. X91406 (NH2C12)GfaCfuUfuCfaUf gacuuucauccuggaaauaua
cCfuGfgAfaAfuAfsusAf
124. X91407 (NH2C12)AfaGfcAfaGfaUf aagcaagauauuuuuauaaua
aUfuUfuUfaUfaAfsusAf
125. X91408 (NH2C12)UfgGfgAfuUfuCf ugggauuucauguaaccaaga
aUfgUfaAfcCfaAfsgsAf
126. X91415 (invabasic)(invabasic)gsascu gacuuucauccuggaaauaua
uuCfaUfCfCfuggaaauasusa
(NH2C6)
127 X91416 (invabasic)(invabasic)asasGf aagcaagauauuuuuauaaua
cAfaGfaUfAfUfuUfuuAfuA
faua(NH2C6)
128. X91417 (invabasic)(invabasic)usgsg ugggauuucauguaaccaaga
gauUfuCfAfUfguaaccaaga
(NH2C6)
129. X91418 GfsasCfuUfuCfaUfcCfuGfg gacuuucauccuggaaauaua
AfaAfuAfuAf(NH2C6)
130. X91419 AfsasGfcAfaGfaUfaUfuUfu aagcaagauauuuuuauaaua
UfaUfaAfuAf(NH2C6)
131. X91420 UfsgsGfgAfuUfuCfaUfgUfa ugggauuucauguaaccaaga
AfcCfaAfgAf(NH2C6)
132. X91379 gsascuuuCfaUfCfCfuggaaau gacuuucauccuggaaauaua
aua(GalNAc)
133. X91380 asasGfcAfaGfaUfAfUfuUfu aagcaagauauuuuuauaaua
uAfuAfaua(GalNAc)
134. X91446 usgsggauUfuCfAfUfguaacca ugggauuucauguaaccaaga
aga(GalNAc)
135. X38483 usAfsuauUfuCfCfaggaUfgA uauauuuccaggaugaaagucca
faagucscsa
136 X91381 usAfsUfuAfuaAfaAfauaUfc uauuauaaaaauaucuugcuuuu
UfuGfcuususudTdT
137. X38104 usCfsuugGfuuAfcaugAfaAf ucuugguuacaugaaaucccauc
ucccasusc
138. X91398 usAfsuAfuUfuCfcAfgGfaUf uauauuuccaggaugaaagucca
gAfaAfgUfcsCfsa
139. X91400 usAfsuUfaUfaAfaAfaUfaUf uauuauaaaaauaucuugcuuuu
cUfuGfcUfus UfsudTdT
140. X91402 usCfsuUfgGfuUfaCfaUfgAf ucuugguuacaugaaaucccauc
aAfuCfcCfasUfsc
141. X91409 (GalNAc- gacuuucauccuggaaauaua
T2)(NH2C12)gacuuuCfaUf
CfCfuggaaauasusa(invabasic)
(invabasic)
142. X91410 (GalNAc- aagcaagauauuuuuauaaua
T2)(NH2C12)aaGfcAfaGfa
UfAfUfuUfuuAfuAfasusa
(invabasic)(invabasic)
143. X91411 (GalNAc- ugggauuucauguaaccaaga
T2)(NH2C12)ugggauUfuCf
AfUfguaaccaasgsa(invabasic)
(invabasic)
144. X91412 (GalNAc- gacuuucauccuggaaauaua
T2)(NH2C12)GfaCfuUfuCf
aUfcCfuGfgAfaAfuAfsusAf
145. X91413 (GalNAc- aagcaagauauuuuuauaaua
T2)(NH2C12)AfaGfcAfaGf
aUfaUfuUfuUfaUfaAfsusAf
146. X91414 (GalNAc- ugggauuucauguaaccaaga
T2)(NH2C12)UfgGfgAfuUf
uCfaUfgUfaAfcCfaAfsgsAf
147. X91433 (invabasic)(invabasic)gsascu gacuuucauccuggaaauaua
uuCfaUfCfCfuggaaauasusa
(NHC6)(GalNAc-T2)
148. X91434 (invabasic)(invabasic)asasGf aagcaagauauuuuuauaaua
cAfaGfaUfAfUfuUfuuAfuA
faua(NHC6)(GalNAc-T2)
149. X91435 (invabasic)(invabasic)usgsg ugggauuucauguaaccaaga
gauUfuCfAfUfguaaccaaga
(NHC6)(GalNAc-T2)
150. X91436 GfsasCfuUfuCfaUfcCfuGfg gacuuucauccuggaaauaua
AfaAfuAfuAf(NHC6)
A(GalNc-T2)
151. X91437 AfsasGfcAfaGfaUfaUfuUfu aagcaagauauuuuuauaaua
UfaUfaAfuAf(NHC6)
(GalNAc-T2)
152. X91438 UfsgsGfgAfuUfuCfaUfgUfa ugggauuucauguaaccaaga
AfcCfaAfgAf(NHC6)
(GalNAc-T2)
153. ETX002 X91409 (GalNAc- gacuuucauccuggaaauaua
T2)(NH2C12)gacuuuCfaUf
CfCfuggaaauasusa(invabasic)
(invabasic)
154. X38483 usAfsuauUfuCfCfaggaUfgA uauauuuccaggaugaaagucca
faagucscsa
155. ETX004 X91412 (ET-GalNAc- gacuuucauccuggaaauaua
T2CO)(NH2C12)GfaCfuUf
uCfaUfcCfuGfgAfaAfuAfsu
sAf
156. X91398 usAfsuAfuUfuCfcAfgGfaUf uauauuuccaggaugaaagucca
gAfaAfgUfcsCfsa
157. ETX006 X91433 (invabasic)(invabasic)gsascu gacuuucauccuggaaauaua
uuCfaUfCfCfuggaaauasusa
(NHC6)(GalNAc-T2)
158. X38483 usAfsuauUfuCfCfaggaUfgA uauauuuccaggaugaaagucca
faagucscsa
159. ETX008 X91436 GfsasCfuUfuCfaUfcCfuGfg gacuuucauccuggaaauaua
AfaAfuAfuAf(NHC6)
(GalNAc-T2)
160. X91398 usAfsuAfuUfuCfcAfgGfaUf uauauuuccaggaugaaagucca
gAfaAfgUfcsCfsa
161. ETX011 X91410 (GalNAc- aagcaagauauuuuuauaaua
T2)(NH2C12)aaGfcAfaGfa
UfAfUfuUfuuAfuAfasusa
(invabasic)(invabasic)
162. X91381 usAfsUfuAfuaAfaAfauaUfc uauuauaaaaauaucuugcuuuu
UfuGfcuususudTdT
163. ETX013 X91413 (GalNAc- aagcaagauauuuuuauaaua
T2)(NH2C12)AfaGfcAfaGf
aUfaUfuUfuUfaUfaAfsusAf
164. X91400 usAfsuUfaUfaAfaAfaUfaUf uauuauaaaaauaucuugcuuuu
cUfuGfcUfusUfsudTdT
165. ETX015 X91434 (invabasic)(invabasic)asasGf aagcaagauauuuuuauaaua
cAfaGfaUfAfUfuUfuuAfuA
faua(NHC6)(GalNAc-T2)
166. X91381 usAfsUfuAfuaAfaAfauaUfc uauuauaaaaauaucuugcuuuu
UfuGfcuususudTdT
167. ETX017 X91437 AfsasGfcAfaGfaUfaUfuUfu aagcaagauauuuuuauaaua
UfaUfaAfuAf(NHC6)
(GalNAc-T2)
168. X91400 usAfsuUfaUfaAfaAfaUfaUf uauuauaaaaauaucuugcuuuu
cUfuGfcUfus UfsudTdT
Duplex SSRN
Seq ID ID ID Sense Sequence 5′ → 3′ Antisense Sequence 5′ → 3′ Clean Sequence
169. ETX020 X91411 (GalNAc- ugggauuucauguaaccaaga
T2)(NH2C12)ugggauUfuCf
AfUfguaaccaasgsa(invabasic)
(invabasic)
170. X38104 usCfsuugGfuuAfcaugAfaAf ucuugguuacaugaaaucccauc
ucccasusc
171. ETX022 X91414 (GalNAc- ugggauuucauguaaccaaga
T2)(NH2C12)UfgGfgAfuUf
uCfaUfgUfaAfcCfaAfsgsAf
172. X91402 usCfsuUfgGfuUfaCfaUfgAf ucuugguuacaugaaaucccauc
aAfuCfcCfasUfsc
173. ETX024 X91435 (invabasic)(invabasic)usgsg ugggauuucauguaaccaaga
gauUfuCfAfUfguaaccaaga
(NHC6)(GalNAc-T2)
174. X38104 usCfsuugGfuuAfcaugAfaAf ucuugguuacaugaaaucccauc
ucccasusc
175. ETX026 X91438 UfsgsGfgAfuUfuCfaUfgUfa ugggauuucauguaaccaaga
AfcCfaAfgAf(NHC6)
(GalNAc-T2)
176. X91402 usCfsuUfgGfuUfaCfaUfgAf ucuugguuacaugaaaucccauc
aAfuCfcCfasUfsc
Key:
Key for SEQ ID NOs: 1-24
ia inverted abasic nucleotide (1,2-dideoxyribose)
m 2′-O-methyl nucleotide
f 2′-deoxy-2′-fluoro nucleotide
S phosphorothioate internucleotide linkage (Phosphorothioate backbone modification)
~ tether
Td Deoxythymidine
Key for SEQ ID NOs: 25-176
dG, dC, dA, dT DNA residues
GalNAc N-Acetylgalactosamine
G, C, A, U RNA residues
g, c, a, u 2′-O-Methyl modified residues
Gf, Cf, Af, Uf 2′-Fluoro modified residues
s Phosphorothioate backbone modification
siRNA small interfering RNA
MFCO Monofluoro cyclooctyne
invabasic 1,2-dideoxyribose
(invabasic)(invabasic) Nucleotides in an overall polynucleotide which are the terminal 2 nucleotides which have sugar moieties that are (i) abasic, and (ii) in an inverted configuration, whereby the bond between the penultimate nucleotide and the antepenultimate nucleotide has a reversed linkage, namely either a 5-5 or a 3-3 linkage
NH2-DEG/NHDEG Aminoethoxyethyl linker
NH2C12 Aminododecyl linker
NH2C6/NHC6 Aminohexyl linker
ET (E-therapeutics - company reference)
(ET-GalNAc-T1N3)(MFCO)(NH-DEG) tether T1b
(ET-GalNAc-T2CO)(NH2C12) tether T2b
(NHC6)(MFCO)(ET-GalNAc-T1N3)tether T1a
(NHC6)(ET-GalNAc-T2CO) tether T2a
T1N3 T1 tether
T2Co T2 tether
(GalNAc-)T1 GalNac T1 tether
(GalNAc-)T2 GalNac T2 tether
Note:
the key ref
Figures (20)
Citations
This patent cites (27)
- US7452987
- US7528188
- US8273866
- US9150606
- US10119136
- US10266825
- US10995336
- US11504391
- US11725207
- US2019/0350962
- US2020/0270611
- US2023/0256001
- US2023/0310486
- US2023/0407311
- US2024/0336922
- US2014179620
- US2014179626
- US2014205451
- US2015042447
- US2018132432
- US2018140920
- US2020097342
- US2020172755
- US2020237391
- US2021261992
- US2022162153
- US2022162154